Process for producing aggregated oligonucleotides
The invention provides processes for the producing compositions comprising (i) a virus-like particle, wherein said virus-like particle is a virus-like particle of an RNA bacteriophage, and (ii) an oligonucleotide, wherein said oligonucleotide is packaged into said virus-like particle. The invention further provides processes for producing nucleotide compositions comprising oligonucleotides suitable to be used in the processes mentioned before. The invention further provides nucleotide compositions obtainable by the processes of the invention and uses thereof. The invention further provides compositions comprising (i) a virus-like particle, wherein said virus-like particle is a virus-like particle of an RNA bacteriophage, and (ii) an oligonucleotide, wherein said oligonucleotide is packaged into said virus-like particle, wherein said compositions are obtainable by the processes of the invention and wherein said compositions preferably comprises a purity of at least 98%, most preferably of at least 99%.
1. A process for producing an nucleotide composition comprising aggregated oligonucleotides, said process comprising the steps of:
(a) providing at least two oligonucleotides in solution I, wherein said oligonucleotides comprise at their 5′ end at least 3 and at most 15 guanosine entities and at their 3′ end at least 3 and at most 15 guanosine entities, wherein each oligonucleotide of said oligonucleotides comprise 20 to 40 nucleotides, and wherein said solution I comprises a pH of 10 to 13;
(b) disaggregating said oligonucleotides, wherein said disaggregating comprises the steps of
(i) adjusting the temperature of solution I to temperature I, wherein said temperature I is 20 to 70° C.;
(ii) incubating said oligonucleotides in said solution I at said temperature I, wherein said incubating is performed until said oligonucleotides comprise a relative peak start time above 110%, and wherein said relative peak start time is determined in size exclusion HPLC with the capsid of an RNA bacteriophage as the standard; and
(iii) adjusting the temperature of said solution I to temperature II, wherein said temperature II is 0 to 10° C.;
(c) adjusting the pH of said solution I to 5 to 8; and
(d) aggregating said oligonucleotides, wherein said aggregating comprises the steps of:
(i) providing said oligonucleotides in said solution I and generating a solution II, wherein said solution II further comprises at least 20 mM of a cation, wherein said cation is selected from the group consisting of Na + , NH 4 + , Li + , Ca 2+ , and Mg 2+ ;
(ii) adjusting the temperature of solution II to temperature III, wherein said temperature III is 50 to 99° C.;
(iii) incubating said oligonucleotides in solution II at temperature III, wherein said incubating is performed until said oligonucleotides comprise a relative peak start time of 80 to 110%, wherein said relative peak start time is determined in size exclusion HPLC with the capsid of an RNA bacteriophage as the standard; and
(iv) adjusting the temperature of solution II to temperature IV, wherein said temperature IV is 0 to 10° C.
2. The process of claim 1 , wherein said temperature I is 45 to 70° C.
3. The process of claim 1 , wherein said adjusting of the temperature of said solution I to temperature II is performed with a temperature ramp of at least 3.6° C./min.
4. The process of claim 1 , wherein said solution I comprises potassium hydroxide or sodium hydroxide.
5. The process of claim 1 , wherein said adjusting of the pH of said solution I is performed by the addition of phosphoric acid, and wherein said adjusting of the pH of said solution I is performed until said pH is 6 to 7.
6. The process of claim 1 , wherein said cation is Na + or K + , and wherein said solution II comprises 200 to 275 mM of said cation.
7. The process of claim 1 , wherein the concentration of said oligonucleotides in said solution I is 50 μM to 2 mM.
8. The process of claim 1 , wherein the concentration of said oligonucleotides in said solution II is 50 μM to 2 mM.
9. The process of claim 1 , wherein said incubating of said oligonucleotides in solution II at temperature III is performed until said oligonucleotides comprise a relative peak start time of 80 to 95%, and wherein said relative peak start time is determined in size exclusion HPLC with the capsid of an RNA bacteriophage as the standard.
10. The process of claim 1 , wherein said oligonucleotides comprise a nucleic acid sequence selected from the group consisting of:
(a) “G4-4”
GGGGGACGATCGTCGGGG;
(SEQ ID NO: 2)
(b) “G5-5”
GGGGGGACGATCGTCGGGGG;
(SEQ ID NO: 3)
(c) “G6-6”
GGGGGGGACGATCGTCGGGGGG;
(SEQ ID NO: 4)
(d) “G7-7”
GGGGGGGGACGATCGTCGGGGGGG;
(SEQ ID NO: 5)
(e) “G8-8”
GGGGGGGGGACGATCGTCGGGGGGGG;
(SEQ ID NO: 6)
(f) “G9-9”
GGGGGGGGGGACGATCGTCGGGGGGGGG;
(SEQ ID NO: 7)
(g) “G10”
GGGGGGGGGGGACGATCGTCGGGGGGGGGG;
(SEQ ID NO: 8)
(h) “G11”
GGGGGGGGGGGGACGATCGTCGGGGGGGGGGG.
(SEQ ID NO: 9)
11. The process of claim 1 , wherein said oligonucleotides comprise the nucleic acid sequence “G10” GGGGGGGGGG GACGATCGTC GGGGGGGGGG (SEQ ID NO:8).
12. The process of claim 1 , wherein said adjusting the temperature of solution II to temperature IV is performed with a temperature ramp of at least 3.6° C./min.
13. The process of claim 1 , wherein said oligonucleotides comprise a palindromic sequence, wherein said palindromic sequence is GACCATCGTC (SEQ ID NO:1).
14. The process of claim 1 , wherein said relative peak start time is determined in size exclusion HPLC with the capsid of an RNA bacteriophage Qβ as the standard.
15. The process of claim 9 , wherein said relative peak start time is determined in size exclusion HPLC with the capsid of an RNA bacteriophage Qβ as the standard.
16. The process of claim 1 , wherein said temperature I is room temperature.
17. The process of claim 1 , wherein said temperature I is about 50° C.
18. The process of claim 1 , wherein said temperature II is 0 to 2° C.
19. The process of claim 1 , wherein said temperature IV is 0 to 2° C.
20. The process of claim 1 , wherein said oligonucleotides consist of the nucleic acid sequence “G10” GGGGGGGGGG GACGATCGTC GGGGGGGGGG (SEQ ID NO:8).