Methods of diagnosing non-urinary tract diseases by detecting aberrant methylation

1. A method for detecting aberrant hypermethylation of the vimentin gene comprising:

obtaining a biological sample derived from a subject; and

subjecting said sample to a two-step nested real time PCR assay wherein the first PCR primer set of a forward primer having the sequence of gctcttcgtggtgtggtgcggttcgggtatcgc (SEQ ID NO:5) and a reverse primer having a sequence of gctcttcgtggtgtggtgctccGactaaaactcGacc (SEQ ID NO:6), wherein the twenty-third guanine residue and the thirty-fourth guanine residue are locked nucleic acid residues; and the second PCR primer set of a forward primer having the sequence of gtgtggtgcggtt (SEQ ID NO: 51) and a reverse primer having the sequence of gtgtggtgctccga (SEQ ID NO: 10), and a probe of FAM-atcgcgagtcggtcgagtt-BHQ 1(SEQ ID NO: 9),

thereby determining the absence or presence of aberrant hypermethylation of the vimentin gene in said subject.