RNA sequences that induce fluorescence of small molecule fluorophores
The present invention relates to novel nucleic acid molecules, called aptamers, that bind specifically to a small molecule fluorophore and thereby enhance the fluorescence signal of the fluorophore upon exposure to radiation of suitable wavelength. Molecular complexes formed between the novel fluorophores, novel nucleic acid molecules, and their target molecules are described, and the use of multivalent aptamer constructs as fluorescent sensors for target molecules of interest are also described.
1. A nucleic acid molecule comprising the nucleotide sequence of:
SEQ ID NO: 74
(i) GAGANGGUCGGGUCCAGN-N-GCUGUNGAGUAGAGUGUGGGCUC,
where N at each of positions 5, 18, and 25 can be any single nucleotide base, and N at position 19 can be any single nucleotide base or an insertion of any length of various nucleotide bases; or
SEQ ID NO: 76
(ii) CGANGAAGGAGGUCUNAGGAGGUCANNG,
where N at each of positions 4, 16, 26, and 27 can be any single nucleotide base; or
SEQ ID NO: 77
(iii) GAGACGGUCGGGUCCAG-N-CUGUUGAGUAGNGUGUGGGCUC,
where N at position 18 can be any single nucleotide base (A, U, G, or C) or an insertion of any length of various nucleotide bases, and N at position 30 can be G or A; and
wherein the nucleic acid molecule binds to a conditionally fluorescent fluorophore molecule.
2. The nucleic acid molecule according to claim 1 , wherein the nucleotide sequence is
SEQ ID NO: 75
GAGACGGUCGGGUCCAGAUAUUCGUAUCUGUCGAGUAGAGUGUGGGCU
C,.
3. The nucleic acid molecule according to claim 1 , further comprising an additional nucleotide sequence inserted at position 19 of SEQ ID NO: 75 or position 18 of SEQ ID NO: 77 which comprises a pair of antiparallel stem-forming sequences and an analyte-binding domain that comprises a nucleotide sequence that adopts a conformation to allow the analyte-binding domain to bind specifically to an analyte.
4. The nucleic acid molecule according to claim 3 , wherein the portion binds the fluorophore molecule with low affinity, and the fluorophore exhibits low fluorescence, in the absence of analyte binding to the analyte-binding domain.
5. The nucleic acid molecule according to claim 3 , wherein the analyte is a small molecule, cellular signaling molecule, a protein, a lipid, a carbohydrate, a hormone, a cytokine, a chemokine, a metabolite, or a metal ion.
6. A detection array comprising one or more nucleic acid molecules according to claim 1 tethered to a discrete location on a surface of the array.
7. A molecular complex comprising:
a fluorophore molecule comprising a methyne bridge between a substituted aromatic ring system and a substituted imidazol(thi)one, oxazol(thi)one, pyrrolin(thi)one, or furan(thi)one; and
the nucleotide molecule according to claim 1 bound specifically to the fluorophore molecule;
wherein the fluorophore molecule has substantially enhanced fluorescence, in comparison to the fluorophore molecule prior to specific binding, upon exposure to radiation of suitable wavelength.
8. The molecular complex according to claim 7 , wherein the fluorophore molecule is 4-(3,5-difluoro-4-hydroxybenzylidene)-1,2-dimethyl-imidazol-5-one (“DFHBI”); (Z)-4-(3,5-difluoro-4-hydroxybenzylidene)-2-methyl-1-(2,2,2-trifluoroethyl)-1H-imidazol-5(4H)-one) (“DFHBI-1T”); or 4-(3,5-difluoro-4-hydroxybenzylidene)-1-methyl-5-oxo-4,5-dihydro-1H-imidazole-2-carbaldehyde oxime (“DFHO”).
9. An isolated host cell containing the molecular complex according to claim 7 .
10. A kit comprising:
a fluorophore comprising a methyne bridge between a substituted aromatic ring system and a substituted imidazol(thi)one, oxazol(thi)one, pyrrolin(thi)one, or furan(thi)one ring; and
a nucleic acid molecule according to claim 1 .
11. A constructed DNA molecule encoding an RNA molecule according to claim 1 .
12. An expression system comprising an expression vector into which is inserted a DNA molecule according to claim 11 .
13. A transgenic host cell comprising the expression system of claim 12 , wherein the transgenic host cell is either isolated, non-human, or both isolated and non-human.
14. A genetic construct comprising a promoter sequence operably linked to a first DNA sequence that encodes an RNA molecule according claim 1 and a second DNA sequence that contains one or more enzymatic cleavage sites.
15. A method of detecting a target molecule comprising:
forming a molecular complex according to claim 7 ;
exciting the fluorophore with radiation of appropriate wavelength; and
detecting fluorescence by the fluorophore, whereby fluorescence by the fluorophore identifies presence of the target molecule.
16. The method according to claim 15 , wherein said forming is carried out in a cell.