Method to assess human allograft status from microrna expression levels
The invention relates to, among other things, a method for assessing risk of organ rejection in a patient having a transplanted organ. The method includes measuring an amount of expression of a small non-coding marker RNA in a biological sample from the patient. The method further includes comparing the measured amount of expression of the small non-coding marker RNA in the patient to a reference amount of expression of the small non-coding marker RNA. In another aspect, the invention relates to kits for assessing risk of organ rejection in a patient having a transplanted organ.
1. A method comprising:
(a) measuring expression of one or a combination of small non-coding marker RNAs in a sample comprising kidney, blood, and/or urine from a patient by quantitative polymerase chain reaction to generate a measured amount of expression, wherein said one or a combination of small non-coding marker RNA(s) is selected from the group of SEQ. ID NOs: 1-9 and 50;
b) quantifying a difference between the measured amount of expression in step (a) and a reference amount of expression of said one or a combination of small non-coding marker RNAs in a person having a non-rejected organ or a second biological sample from the patient; and
(c) administering an anti-rejection treatment to the patient to reduce a risk of kidney transplant rejection when an increase of expression of at least two-fold is detected of said small non-coding marker RNA(s) in the sample compared to said reference amount.
2. The method according to claim 1 , wherein the small non-coding marker RNA is miR-142-5p CAUAAAGUAGAAAGCACUAC (SEQ ID NO:1).
3. The method according to claim 1 , wherein the small non-coding marker RNA is miR-142-3p UGUAGUGUUUCCUACUUUAUGGA (SEQ ID NO:2).
4. The method according to claim 1 , wherein the small non-coding marker RNA is miR-155 UUAAUGCUAAUCGUGAUAGGGG (SEQ ID) NO:3).
5. The method according to claim 1 , wherein the small non-coding marker RNA is miR-146a UGAGAACUGAAUUCCAUGGGUU (SEQ ID NO:4).
6. The method according to claim 1 , wherein the small non-coding marker RNA is miR-146b UGAGAACUGAAUUCCAUAGGCU (SEQ ID NO:5).
7. The method according to claim 1 , wherein the small non-coding marker RNA is miR-342 UCUCACACAGAAAUCGCACCCGUC (SEQ ID NO:6).
8. The method according to claim 1 , wherein the small non-coding marker RNA is miR-650 AGGAGGCAGCGCUCUCAGGAC (SEQ ID NO:7).
9. The method according to claim 1 , wherein the small non-coding marker RNA is miR-21 UAGCUUAUCAGACUGAUGUUGA (SEQ ID NO:8).
10. The method according to claim 1 , wherein the small non-coding marker RNA is miR-425-5p AAUGACACGAUCACUCCCGUUGA (SEQ ID NO:9).
11. The method according to claim 1 , wherein the small non-coding marker RNA is miR 223 UGUCAGUUUGUCAAAUACCCC (SEQ ID NO:50).
12. The method according to claim 1 , wherein the sample comprises a urine sample.
13. The method according to claim 1 , wherein said reference amount is obtained by measuring an amount of expression of the small non-coding marker RNA(s) in a person having a non-rejected organ.
14. The method according to 1 , wherein said reference amount is obtained by measuring an amount of expression of said small non-coding marker RNA in a second biological sample from the patient.