Spinal muscular atrophy (SMA) treatment via targeting of SMN2 splice site inhibitory sequences
The present invention is directed to methods and compositions capable of blocking the inhibitory effect of a newly-identified intronic inhibitory sequence element, named ISS-N1 (for “intronic splicing silencer”), located in the SMN2 gene. The compositions and methods of the instant invention include oligonucleotide reagents (e.g., oligoribonucleotides) that effectively target the SMN2 ISS-N1 site in the SMN2 pre-mRNA, thereby modulating the splicing of SMN2 pre-mRNA to include exon 7 in the processed transcript. The ISS-N1 blocking agents of the invention cause elevated expression of SMN protein, thus compensating for the loss of SMN protein expression commonly observed in subjects with spinal muscular atrophy (SMA).
1. An oligonucleotide consisting of 15 to 40 linked nucleotides or modified nucleotides in length, wherein the oligonucleotide comprises at least one morpholino moiety, and wherein the oligonucleotide comprises a nucleobase sequence at least 80% complementary to intron 7 of the SMN2 gene over the entire length of the oligonucleotide.
2. The oligonucleotide of claim 1 , which is at least 90% complementary to the sequence 5′-CCAGCAUUAUGAAAG-3′ (SEQ ID NO: 3).
3. The oligonucleotide of claim 1 which is 100% complementary to the sequence 5′-CCAGCAUUAUGAAAG-3′ (SEQ ID NO: 3).
4. The oligonucleotide of claim 1 comprising the sequence 5′-CUUUCAUAAUGCUGG-3′ (SEQ ID NO: 4).
5. The oligonucleotide of claim 1 , which is 15-20 nucleotides in length.
6. The oligonucleotide of claim 1 , which is 20-25 nucleotides in length.
7. The oligonucleotide of claim 1 , which is 18 nucleotides in length.
8. The oligonucleotide of claim 1 , wherein one or more nucleotides comprises a modified nucleobase.
9. The oligonucleotide of claim 1 , wherein each riboside moiety of each subunit of the oligonucleotide is a morpholine moiety.
10. A composition comprising the oligonucleotide of claim 1 and a pharmaceutically acceptable carrier.
11. The oligonucleotide of claim 1 , which comprises the complement of the nucleobase sequence CCAGCAUUAUGAAAGUGAAU, set forth as nucleobases 10-29 of SEQ ID NO:103.
12. The oligonucleotide of claim 10 , which consists of the complement of the nucleobase sequence CCAGCAUUAUGAAAGUGAAU, set forth as nucleobases 10-29 of SEQ ID NO:103.
13. A method of increasing the level of exon 7-containing SMN2 mRNA in a cell comprising contacting the cell with the oligonucleotide of claim 1 , such that the level of exon 7-containing SMN2 mRNA in the cell is increased.
14. The method of claim 13 , wherein the oligonucleotide is 15-40 nucleotides in length and is 100% complementary to intron 7 of the SMN2 gene over the full length of the oligonucleotide.
15. The method of claim 13 , wherein the oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 4.
16. The method of claim 13 , wherein the oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 3.
17. The method of claim 16 , wherein the oligonucleotide is 15-20 nucleotides in length.
18. The method of claim 16 , wherein the oligonucleotide is 20-25 nucleotides in length.
19. The method of claim 16 , wherein the oligonucleotide is 18 nucleotides in length.
20. The oligonucleotide of claim 8 , wherein the modified nucleobase is 5-methyl-cytosine.
21. The oligonucleotide of claim 1 , wherein the oligonucleotide is complementary to a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:3 and SEQ ID NO:5.