Peptide-conjugated oligonucleotide therapeutic and method of making and using same
Conjugates for the efficient delivery of sequence-specific antisense to cells of a selected type for the inhibition of a target protein have the general formula: peptide-HBL-antisense in which the peptide is a homing peptide which directs the conjugate to cells of a particular type, antisense is an antisense oligonucleotide having a sequence selected to provide sequence-specific inhibition of the target protein, and HBL is a heterobifunctional linker having reactivity towards amino and sulfhydryl groups.
1. A method of treating a cancer in an individual in need of treatment for the cancer comprising administering to the individual a therapeutically effective amount of a peptide-oligonucleotide conjugate having the general formula:
homing element-GMBS-antisense
in which homing element is a means for directing the conjugate to cells of the cancer, antisense is an antisense gapmer oligonucleotide having a sequence selected to provide sequence-specific inhibition of a target protein, and GMBS is a linking group formed by reaction of 4-maleimidobutyric acid N-hydroxysuccinimide ester with the homing element and the antisense.
2. The method of claim 1 , further comprising the step of administering an inhibitor of hsp90.
3. The method of claim 1 , wherein the cancer is selected from the group consisting of breast cancer, prostate cancer, lung cancer, glioma and other brain cancers, colorectal cancer, pancreatic cancer, liver cancer, and sarcoma.
4. The method of claim 1 , wherein the antisense gapmer oligonucleotide targets a transcription regulating factor in a sequence specific manner.
5. The method of claim 1 , wherein the antisense gapmer oligonucleotide targets Id1.
6. The method of claim 5 , wherein the antisense gapmer oligonucleotide comprises the sequence gcaccagctccttgaggcgtgag (Seq. ID No. 1) or an RNA counter-part thereof.
7. The method of claim 1 , wherein the homing element directs the conjugate to tumor endothelium.
8. The method of claim 7 , wherein the homing element portion of the conjugate comprises a peptide of the sequence:
(Seq. ID No. 3)
CKDEPQRRSARLSAKPAPPKPEPKPKKAPAKK.
9. The method of claim 7 , wherein the homing element portion of the conjugate comprises a peptide of the sequence:
(Seq. ID No. 4)
WIFPWIQL
or
(Seq. ID No. 5)
WDLAWMFRLPVG.
10. The method of claim 7 , wherein the antisense gapmer oligonucleotide targets a transcription regulating factor in a sequence specific manner.
11. The method of claim 7 , wherein the antisense gapmer oligonucleotide targets Id1.
12. The method of claim 11 , wherein the antisense gapmer oligonucleotide comprises the sequence gcaccagctccttgaggcgtgag (Seq. ID No. 1) or an RNA counter-part thereof.
13. The method of claim 1 , wherein the homing element portion of the conjugate comprises a sequence selected from Seq. ID Nos. 10-30 and 33-35.
14. The method of claim 1 , wherein the antisense gapmer oligonucleotide consists of SEQ ID NO.: 2.
15. The method of claim 1 , wherein the cancer is glioma and the means for directing the conjugate to cells of a particular type targets the conjugate to glioma cells.
16. The method of claim 15 , wherein the homing element portion of the conjugate comprises a sequence selected from the group consisting of SEQ ID NOs: 33, 34 and 35.
17. The method of claim 1 , wherein the cancer is a sarcoma, and the means for directing the conjugate to cells of a particular type targets the conjugate to angiosarcoma cells.
18. The method of claim 17 , wherein the homing element portion of the conjugate comprises a sequence selected from the group consisting of SEQ ID NOs: 10, 11, 12, 13, and 14.
19. The method of claim 1 , wherein the cancer is breast cancer and the means for directing the conjugate to cells of a particular type targets the conjugate to breast cancer cells.
20. The method of claim 19 , wherein the homing element portion of the conjugate comprises a sequence selected from the group consisting of SEQ ID NOs: 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 and 30.
21. A method of treating a cancer in an individual in need of treatment for the cancer comprising administering to the individual a therapeutically effective amount of a peptide-oligonucleotide conjugate having the general formula:
peptide-HBL-antisense
in which peptide is a homing peptide which directs the conjugate to cells of the cancer, antisense is an antisense oligonucleotide having a sequence selected to provide sequence-specific inhibition of a target protein, and HBL is a heterobifunctional linker having reactivity towards amino and sulfhydryl groups, and in which the antisense oligonucleotide comprises the Seq ID No. 1 or 31 or an RNA counter-part thereof.
22. The method of claim 21 , wherein the peptide directs the conjugate to tumor endothelium.
23. The method of claim 21 , wherein HBL is GMBS or EMCS.