IP Library Granted Patent US 10,077,445
Granted Patent B2
US 10,077,445 · App. 15/138,604 · Granted Sep 18, 2018

Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription

Inventors: Jennifer A. Doudna (Berkeley, CA); Martin Jinek (Berkeley, CA); Krzysztof Chylinski (Vienna, AT); Emmanuelle Charpentier (Braunschweig, DE)
Assignees: The Regents of the University of California; University of Vienna; Emmanuelle Charpentier
C12N15/113A61K38/465C12N9/22C12N15/102C12N15/111C12N15/63C12N15/70C12N15/746C12N15/90C12N15/902C12N15/907A61K48/00C12N2310/11C12N2310/13C12N2310/14C12N2310/20C12N2310/31C12N2310/32C12N2310/33C12N2310/3519C12N2310/531C12N2800/80C12Y301/04
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 10,077,445
App. No.
15/138,604
Granted
Sep 18, 2018
Kind
B2
Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

Claims (122)

1. A non-naturally occurring DNA-targeting RNA, or a nucleic acid encoding the non-naturally occurring DNA-targeting RNA, wherein the non-naturally occurring DNA-targeting RNA comprises:

(a) a targeter-RNA comprising:

(i) a first nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and

(ii) a second nucleotide sequence that hybridizes with an activator-RNA,

wherein the first and second nucleotide sequences are heterologous to one another; and

(b) the activator-RNA, which hybridizes with the second nucleotide sequence of the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,

wherein the non-naturally occurring DNA-targeting RNA is capable of forming a complex with a Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule.

2. The non-naturally occurring DNA-targeting RNA of claim 1 , or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 10 to 15 base pairs.

3. The non-naturally occurring DNA-targeting RNA of claim 1 , or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 10 base pairs.

4. The non-naturally occurring DNA-targeting RNA of claim 1 , or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein (a) and (b) are not covalently linked to one another by intervening nucleotides.

5. The non-naturally occurring DNA-targeting RNA of claim 1 , or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the nucleotide sequence that is complementary to the target sequence in the target DNA molecule is 15 nucleotides (nt) to 18 nt long.

6. The non-naturally occurring DNA-targeting RNA of claim 1 , or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the nucleotide sequence that is complementary to the target sequence in the target DNA molecule is 18 nucleotides (nt) to 25 nt long.

7. The non-naturally occurring DNA-targeting RNA of claim 1 , or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the target DNA molecule is chromosomal DNA.

8. The non-naturally occurring DNA-targeting RNA of claim 1 , or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).

9. The non-naturally occurring DNA-targeting RNA of claim 1 , or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the activator-RNA comprises the 67 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU UUU (SEQ ID NO: 432).

10. The non-naturally occurring DNA-targeting RNA of claim 1 , or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the non-naturally occurring DNA-targeting RNA or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA is conjugated to a heterologous moiety.

11. The non-naturally occurring DNA-targeting RNA of claim 10 , or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the heterologous moiety is an intercalator, a reporter molecule, a polyamine, a polyamide, a polyethylene glycol, a polyether, a cholesterol, a lipid, a cholic acid, a thioether, a thiocholesterol, an aliphatic chain, a phospholipid, an adamantane acetic acid, a palmityl moiety, an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety, a biotin, a phenazine, a folate, a phenanthridine, an anthraquinone, an acridine, a fluorescein, a rhodamine, a fluor, a coumarin, a dye, or a protein transduction domain.

12. A non-naturally occurring DNA-targeting RNA that comprises:

(a) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and

(b) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,

wherein the non-naturally occurring DNA-targeting RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase, and

wherein the non-naturally occurring DNA-targeting RNA is capable of forming a complex with a Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule.

13. The non-naturally occurring DNA-targeting RNA of claim 12 , comprising a non-natural internucleoside linkage that comprises one or more of: a phosphorothioate, a phosphoramidate, a non-phosphodiester, a heteroatom, a chiral phosphorothioate, a phosphorodithioate, a phosphotriester, an aminoalkylphosphotriester, a 3′-alkylene phosphonates, a 5′-alkylene phosphonate, a chiral phosphonate, a phosphinate, a 3′-amino phosphoramidate, an aminoalkylphosphoramidate, a phosphorodiamidate, a thionophosphoramidate, a thionoalkylphosphonate, a thionoalkylphosphotriester, a selenophosphate, and a boranophosphate.

14. The non-naturally occurring DNA-targeting RNA of claim 12 , comprising one or more of: (i) a non-natural internucleoside linkage that is a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage; (ii) a locked nucleic acid (LNA); and (iii) a modified sugar moiety that is 2′-O methoxyethyl, 2′-O-methyl, or 2′-fluoro.

15. The non-naturally occurring DNA-targeting RNA of claim 12 , comprising one or more peptide nucleic acids (PNAs), morpholino nucleic acids, cyclohexenyl nucleic acids (CeNAs), and/or locked nucleic acids (LNAs).

16. The non-naturally occurring DNA-targeting RNA of claim 12 , comprising one or more of: a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, a 2′-dimethylaminoethoxyethoxy modified sugar moiety, a 2′-O-methyl modified sugar moiety, and a 2′-fluoro modified sugar moiety.

17. The non-naturally occurring DNA-targeting RNA of claim 12 , comprising a nucleobase comprising one or more of: a 5-methylcytosine; a 5-hydroxymethyl cytosine; a xanthine; a hypoxanthine; a 2-aminoadenine; a 6-methyl derivative of adenine; a 6-methyl derivative of guanine; a 2-propyl derivative of adenine; a 2-propyl derivative of guanine; a 2-thiouracil; a 2-thiothymine; a 2-thiocytosine; a 5-halouracil; a 5-halocytosine; a 5-propynyl uracil; a 5-propynyl cytosine; a 6-azo uracil; a 6-azo cytosine; a 6-azo thymine; a pseudouracil; a 4-thiouracil; an 8-halo; an 8-amino; an 8-thiol; an 8-thioalkyl; an 8-hydroxyl; a 5-halo; a 5-bromo; a 5-trifluoromethyl; a 5-substituted uracil; a 5-substituted cytosine; a 7-methylguanine; a 7-methyladenine; a 2-F-adenine; a 2-amino-adenine; all 8-azaguanine; an 8-azaadenine; a 7-deazaguanine; a 7-deazaadenine; a 3-deazaguanine; a 3-deazaadenine; a tricyclic pyrimidine; a phenoxazine cytidine; a phenothiazine cytidine; a substituted phenoxazine cytidine; a carbazole cytidine; a pyridoindole cytidine; a 7-deaza-adenine; a 7-deazaguanosine; a 2-aminopyridine; a 2-pyridone; a 5-substituted pyrimidine; a 6-azapyrimidine; an N-2, N-6or O-6 substituted purine; a 2-aminopropyladenine; a 5-propynyluracil; and a 5-propynylcytosine.

18. The non-naturally occurring DNA-targeting RNA of claim 12 , wherein (a) and (b) are not covalently linked to one another by intervening nucleotides.

19. One or more nucleic acids encoding a non-naturally occurring DNA-targeting RNA that comprises:

(a) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and

(b) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,

wherein the non-naturally occurring DNA-targeting RNA is capable of forming a complex with a Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule, and

wherein the one or more nucleic acids comprises a first nucleotide sequence encoding the targeter-RNA and a second nucleotide sequence encoding the activator-RNA; wherein the first nucleotide sequence, the second nucleotide sequence, or both, is operably linked to a heterologous transcriptional control sequence and/or a heterologous translational control sequence.

20. The one or more nucleic acids of claim 19 , wherein the one or more nucleic acids are one or more recombinant expression vectors.

21. The one or more nucleic acids of claim 19 , wherein the one or more nucleic acids are plasmids, cosmids, minicircles, phage, or viral vectors.

22. The one or more nucleic acids of claim 19 , wherein the one or more nucleic acids are vaccinia, polio, retro, lenti, adeno, adeno-associated, or herpes simplex viral vectors.

23. The one or more nucleic acids of claim 19 , wherein the first nucleotide sequence is operably linked to said heterologous transcriptional control sequence, wherein said heterologous transcriptional control sequence is a promoter.

24. The one or more nucleic acids of claim 23 , wherein the promoter is an inducible promoter.

25. The one or more nucleic acids of claim 19 , wherein the second nucleotide sequence is operably linked to said heterologous transcriptional control sequence, wherein said heterologous transcriptional control sequence is a promoter.

26. The one or more nucleic acids of claim 25 , wherein the promoter is an inducible promoter.

27. The one or more nucleic acids of claim 19 , wherein one nucleic acid encodes both the targeter-RNA and the activator-RNA.

28. The one or more nucleic acids of claim 19 , wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 10 to 15 base pairs.

29. The one or more nucleic acids of claim 19 , wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 10 base pairs.

30. The one or more nucleic acids of claim 19 , wherein (a) and (b) are not covalently linked to one another by intervening nucleotides.

31. The one or more nucleic acids of claim 19 , wherein the nucleotide sequence that is complementary to the target sequence in the target DNA molecule is 15 nucleotides (nt) to 18 nt long.

32. The one or more nucleic acids of claim 19 , wherein the nucleotide sequence that is complementary to the target sequence in the target DNA molecule is 18 nucleotides (nt) to 25 nt long.

33. The one or more nucleic acids of claim 19 , wherein the target DNA molecule is chromosomal DNA.

34. The one or more nucleic acids of claim 19 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).

35. The one or more nucleic acids of claim 19 , wherein the activator-RNA comprises the 67 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU UUU (SEQ ID NO: 432).

36. A composition comprising:

(1) a non-naturally occurring DNA-targeting RNA, or a nucleic acid encoding the non-naturally occurring DNA-targeting RNA, wherein the non-naturally occurring DNA-targeting RNA comprises:

(a) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and

(b) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,

wherein the non-naturally occurring DNA-targeting RNA is capable of forming a complex with a Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule; and

(2) one or more of: a nuclease inhibitor, a buffering agent, a detergent, a polyamine, an adjuvant, a wetting agent, a stabilizing agent, an antioxidant, and a complexing agent.

37. The composition of claim 36 , comprising the buffering agent.

38. The composition of claim 37 , wherein the buffering agent is a buffer for stabilizing nucleic acids.

39. The composition of claim 36 , wherein the composition is present as a therapeutic formulation for administration to an animal or human.

40. The composition of claim 36 , wherein the composition is sterile.

41. The composition of claim 36 , wherein the composition is in a vial, bag, or ampule.

42. The composition of claim 36 , wherein the composition is lyophilized.

43. The composition of claim 36 , wherein the composition comprises a Cas9 polypeptide and the non-naturally occurring DNA-targeting RNA.

44. The composition of claim 43 , wherein the Cas9 polypeptide is fused to a heterologous polypeptide.

45. The composition of claim 44 , wherein the heterologous polypeptide is a protein tag or a Protein Transduction Domain (PTD).

46. The composition of claim 43 , wherein the Cas9 polypeptide comprises one or more mutations in a RuvC and/or HNH endonuclease domain.

47. The composition of claim 36 , wherein (a) and (b) are not covalently linked to one another by intervening nucleotides.

48. A lyophilized composition of a non-naturally occurring DNA-targeting RNA, or a nucleic acid encoding the non-naturally occurring DNA-targeting RNA, wherein the non-naturally occurring DNA-targeting RNA comprises:

(a) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and

(b) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the taraeter-RNA to form a total of 8 to 15 base pairs,

wherein the non-naturally occurring DNA-targeting RNA is capable of forming a complex with a Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule.

49. The lyophilized composition of claim 48 , comprising a buffering agent.

50. The lyophilized composition of claim 49 , wherein the buffering agent is a buffer for stabilizing nucleic acids.

51. The lyophilized composition of claim 48 , formulated for administration to an animal or human.

52. The lyophilized composition of claim 48 , that is sterile.

53. The lyophilized composition of claim 48 , wherein (a) and (b) are not covalently linked to one another by intervening nucleotides.

54. A composition comprising:

(1) a Cas9 polypeptide, or a nucleic acid encoding the Cas9 polypeptide; and

(2) a non-naturally occurring DNA-targeting RNA, or a nucleic acid encoding the non-naturally occurring DNA-targeting RNA, wherein the non-naturally occurring DNA-targeting RNA comprises:

(a) a targeter-RNA comprising:

(i) a first nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and

(ii) a second nucleotide sequence that hybridizes with an activator-RNA,

wherein the first and second nucleotide sequences are heterologous to one another; and

(b) the activator-RNA, which hybridizes with the second nucleotide sequence of the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,

wherein the non-naturally occurring DNA-targeting RNA is capable of forming a complex with the Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule.

55. The composition of claim 54 , further comprising: (3) one or more of: a nuclease inhibitor, a buffering agent, a detergent, a polyamine, an adjuvant, a wetting agent, a stabilizing agent, an antioxidant, and a complexing agent.

56. The composition of claim 55 , comprising the buffering agent.

57. The composition of claim 56 , wherein the buffering agent is a buffer for stabilizing nucleic acids and/or proteins.

58. The composition of claim 54 , wherein the composition is present as a therapeutic formulation for administration to an animal or human.

59. The composition of claim 54 , wherein the composition is sterile.

60. The composition of claim 54 , wherein the composition is in a vial, bag, or ampule.

61. The composition of claim 54 , wherein the composition is lyophilized.

62. The composition of claim 54 , wherein the Cas9 polypeptide is fused to heterologous polypeptide.

63. The composition of claim 62 , wherein the Cas9 polypeptide comprises one or more mutations in a RuvC and/or HNH endonuclease domain.

64. The composition of claim 62 , wherein the heterologous polypeptide is a protein tag.

65. The composition of claim 64 , wherein the protein tag is a 6xHis tag, a hemagglutinin tag, or a green fluorescent protein.

66. The composition of claim 54 , wherein the Cas9 polypeptide, or the nucleic acid encoding the Cas9 polypeptide, is conjugated to a protein transduction domain (PTD).

67. The composition of claim 54 , wherein (a) and (b) are not covalently linked to one another by intervening nucleotides.

68. The composition of claim 54 , wherein the Cas9 polypeptide comprises one or more mutations in a RuvC and/or HNH endonuclease domain.

69. A kit comprising:

(1) a Cas9 polypeptide, or a nucleic acid encoding the Cas9 polypeptide; and

(2) a non-naturally occurring DNA-targeting RNA, or a nucleic acid encoding the non-naturally occurring DNA-targeting RNA, wherein the non-naturally occurring DNA-targeting RNA comprises:

(a) a targeter-RNA comprising:

(i) a first nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and

(ii) a second nucleotide sequence that hybridizes with an activator-RNA,

wherein the first and second nucleotide sequences are heterologous to one another; and

(b) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,

wherein the non-naturally occurring DNA-targeting RNA is capable of forming a complex with the Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule, and

wherein (1) and (2) are in the same or separate containers.

70. The kit of claim 69 , further comprising (3) one or more of: a nuclease inhibitor, a buffering agent, a detergent, a polyamine, an adjuvant, a wetting agent, a stabilizing agent, an antioxidant, and a complexing agent.

71. The kit of claim 70 , comprising the buffering agent.

72. The kit of claim 71 , wherein the buffering agent is a buffer for stabilizing nucleic acids and/or proteins.

73. The kit of claim 69 , wherein at least one of (1) and (2) is formulated for administration to an animal or human.

74. The kit of claim 69 , wherein at least one of (1) and (2) is sterile.

75. The kit of claim 69 , wherein at least one of (1) and (2) is in a vial, bag, or ampule.

76. The kit of claim 69 , wherein at least one of (1) and (2) is lyophilized.

77. The kit of claim 69 , wherein the Cas9 protein is fused to a heterologous polypeptide.

78. The kit of claim 77 , wherein the Cas9 polypeptide comprises one or more mutations in a RuvC and/or HNH endonuclease domain.

79. The kit of claim 77 , wherein the heterologous polypeptide is a protein tag.

80. The kit of claim 79 , wherein the protein tag is a 6xHis tag, a hemagglutinin tag, or a green fluorescent protein.

81. The kit of claim 69 , wherein the Cas9 polypeptide, or the nucleic acid encoding the Cas9 polypeptide, is conjugated to a protein transduction domain (PTD).

82. The kit of claim 69 , wherein (a) and (b) are not covalently linked to one another by intervening nucleotides.

83. The composition of claim 69 , wherein the Cas9 polypeptide comprises one or more mutations in a RuvC and/or HNH endonuclease domain.

Assignments (3)
CORRECTIVE ASSIGNMENT TO CORRECT THE LAST NAME OF THE 4TH INVENTOR PREVIOUSLY RECORDED AT REEL: 038554 FRAME: 0746. ASSIGNOR(S) HEREBY CONFIRMS THE ASSIGNMENT. Recorded May 23, 2016
From: DOUDNA, JENNIFER A.; JINEK, MARTIN; QI, LEI S.; DOUDNA CATE, JAMES HARRISON; LIM, WENDELL A.
To: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA
Reel/Frame 038788/0626 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded May 11, 2016
From: CHYLINSKI, KRZYSZTOF
To: UNIVERSITY OF VIENNA
Reel/Frame 038554/0702 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded May 11, 2016
From: DOUDNA, JENNIFER A.; JINEK, MARTIN; QI, LEI S.; CATE, JAMES HARRISON DOUDNA; LIM, WENDELL A.
To: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA
Reel/Frame 038554/0746 →
Continuity (21)
Continuation 14942782 · Nov 16, 2015
Continuation 13842859 · Mar 15, 2013
Continuation 15138604
Continuation 14685516 · Apr 13, 2015
Continuation 13842859
Continuation 15138604
Continuation 14685514 · Apr 13, 2015
Continuation 13842859
Continuation 15138604
Continuation 14685513 · Apr 13, 2015
Continuation 13842859
Continuation 15138604
Continuation 14685504 · Apr 13, 2015
Continuation 13842859
Continuation 14685502 · Apr 13, 2015
Continuation 13842859
Provisional Application 61765576 · Mar 15, 2013
Provisional Application 61757640 · Jan 28, 2013
Provisional Application 61716256 · Oct 19, 2012
Provisional Application 61652086 · May 25, 2012
Related Publication 20170051310A1 · Feb 23, 2017