IP Library › Granted Patent US 50,283
Granted Patent E1
US 50,283 · App. 17/541,846 · Granted Jan 28, 2025

Effective delivery of large genes by dual AAV vectors

Inventors: Alberto Auricchio (Naples, IT); Pasqualina Colella (Naples, IT); Ivana Trapani (Naples, IT)
Assignee: FONDAZIONE TELETHON ETS
C12N15/86A61K48/005C07K14/705C12N2750/14143C12N2800/40C12N2840/20C12N2840/44C12N2840/445
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 50,283
App. No.
17/541,846
Granted
Jan 28, 2025
Kind
E1
Abstract

The present invention relates to constructs, vectors, relative host cells and pharmaceutical compositions which allow an effective gene therapy, in particular of genes larger than 5 Kb.

Claims (303)

1. A dual construct system to express the coding sequence of a gene of interest in a host cell, said coding sequence consisting of a 5′end portion and of a 3′end portion, said dual construct system comprising:

a) a first plasmid comprising, in a 5′-3′ direction:

a 5′-inverted terminal repeat (5′-ITR) sequence;

a promoter sequence;

the 5′ end portion of said coding sequence, said 5′end portion being operably linked to and under control of said promoter;

a nucleic acid sequence of a splicing donor signal; and

a 3′-inverted terminal repeat (3′-ITR) sequence; and

b) a second plasmid comprising, in a 5′-3′ direction:

a 5′-inverted terminal repeat (5′-ITR) sequence;

a nucleic acid sequence of a splicing acceptor signal;

the 3′end of said coding sequence;

a poly-adenylation signal nucleic acid sequence;

a 3′-inverted terminal repeat (3′-ITR) sequence;

wherein the nucleotide sequence of the respective ITRs is obtained from an adeno-associated virus (AAV) of the same AAV serotype or from an AAV of a different serotype;

wherein said first plasmid further comprises a nucleic acid sequence of a recombinogenic region in 5′ position of the 3′ITR of said first plasmid, and wherein said second plasmid further comprises a nucleic acid sequence of a recombinogenic region in 3′ position of the 5′-ITR of said second plasmid; and

wherein the recombinogenic region is an F1 phage recombinogenic region that consists of the sequence:

(SEQ ID NO: 3)

GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA

AAAATTTAACGCGAATTTTAACAAAAT.

2. The dual construct system according to claim 1 , wherein upon introduction of said first plasmid and said second plasmid into the host cell, said coding sequence reconstitutes by means of the splicing donor and the splicing acceptor signals.

3. The dual construct system according to claim 1 , wherein the 3′-ITR of the first plasmid and the 5′-ITR of the second plasmid are from the same AAV serotype.

4. The dual construct system according to claim 1 , wherein the 5′-ITR and 3′-ITR of the first plasmid and the 5′-ITR and 3′-ITR of the second plasmid are respectively from different AAV serotypes.

5. The dual construct system according to claim 1 , wherein the 5′-ITR of the first plasmid and the 3′-ITR of the second plasmid are from different AAV serotypes.

6. The dual construct system according to claim 1 , wherein the coding sequence is split into the 5′ end portion and the 3′ end portion at a natural exon-exon junction.

7. The dual construct system according to claim 1 , wherein the nucleic acid sequence of the splicing donor signal comprises the sequence:

(SEQ ID NO: 1)

GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGG

CTTGTCGAGACAGAGAAGACTCTTGCGTTTCT.

8. The dual construct system according to claim 1 , wherein the nucleic acid sequence of the splicing acceptor signal comprises the sequence

(SEQ ID NO: 2)

GATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACA

G.

9. The dual construct system according to claim 1 , wherein the first plasmid further comprises at least one enhancer sequence, operably linked to the coding sequence.

10. The dual construct system according to claim 1 , wherein the coding sequence is a nucleotide sequence encoding a protein able to correct an inherited retinal degeneration.

11. The dual construct system according to claim 10 , wherein the coding sequence is selected from the group consisting of: ABCA4, MYO7A, CEP290, CDH23, EYS, USH2a, GPR98 and ALMS1.

12. A dual viral vector system comprising:

a) a first viral vector containing the first plasmid, and

b) a second viral vector containing the second plasmid,

wherein said first and said second plasmids are as defined in claim 1 , and

wherein the vectors are adeno-associated virus (AAV) vectors.

13. The dual viral vector system according to claim 12 , wherein the adeno-associated virus (AAV) vectors are the same or different AAV serotypes.

14. The dual viral vector system according to claim 12 , wherein the AAV vectors have a serotype selected from the group consisting of serotype 2, serotype 8, serotype 5, serotype 7 and serotype 9.

15. An isolated host cell transformed with the dual viral vector system according to claim 12 .

16. A pharmaceutical composition comprising the dual construct system according to claim 1 , and a pharmaceutically acceptable vehicle.

17. A method for treating a subject having a disease characterized by a retinal degeneration comprising subretinally administering to said subject an effective amount of the dual viral vector system according to claim 12 .

18. A pharmaceutical composition comprising the dual viral vector system according to claim 12 and a pharmaceutically acceptable vehicle.

19. A pharmaceutical composition comprising the isolated host cell according to claim 15 and a pharmaceutically acceptable vehicle.

20. A first polynucleotide comprising in a 5′-3′ direction:

a 5′-inverted terminal repeat (5′-ITR) sequence;

a promoter sequence;

a 5′ end portion of a coding sequence of a gene of interest, the 5′ end portion being operably linked to and under control of the promoter sequence;

a nucleic acid sequence of a splicing donor signal;

a nucleic acid sequence of a recombinogenic region; and

a 3′-inverted terminal repeat (3′-ITR) sequence,

wherein the ITRs are adeno-associated virus (AAV) ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:

(SEQ ID NO: 3)

GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA

AAAATTTAACGCGAATTTTAACAAAAT;

 or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto.

21. The first polynucleotide of claim 20 , capable of undergoing homologous recombination with a second polynucleotide that comprises the Fl phage recombinogenic region.

22. The first polynucleotide of claim 20 , wherein:

the nucleotide sequence of the 5′-ITR and 3′-ITR are obtained from an AAV of the same AAV serotype or a different AAV serotype;

the nucleotide sequence of the 5′-ITR and 3′-ITR are obtained from AAV serotype 2;

the coding sequence is split into the 5′ end portion at a natural exon-exon junction;

the nucleic acid sequence of the splicing donor signal comprises

(SEQ ID NO: 1)

GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGG

CTTGTCGAGACAGAGAAGACTCTTGCGTTTCT;

the 5′ end portion of the coding sequence of the gene of interest is 4.5 Kb, 5 Kb, 5.5 Kb, 6 Kb, or a smaller size; and/or

the coding sequence is a nucleotide sequence encoding a protein able to correct an inherited retinal degeneration, optionally wherein the coding sequence is selected from the group consisting of the gene coding sequences of: ABCA4, MYO7A, CEP290, CDH23, EYS, USH2a, GPR98, and ALMS1.

23. The first polynucleotide of claim 20 , wherein the promoter sequence is selected from the group consisting of a cytomegalovirus (CMV) promoter sequence, a chicken beta-actin (CBA) promoter sequence, a vitelliform macular dystrophy 2 (VMD2) promoter sequence, a interphotoreceptor retinoid binding protein promoter sequence, a rhodopsin (RHO) promoter sequence, and a rhodopsin kinase (RHOK) promoter sequence, optionally wherein the first polynucleotide further comprises at least one enhancer and/or intron sequence, operably linked to the coding sequence.

24. A first viral vector comprising the first polynucleotide of claim 20 , optionally wherein the vector is an AAV vector, optionally wherein:

the adeno-associated virus is selected from serotype 2, serotype 8, serotype 5, serotype 7, and serotype 9; and/or

the AAV vector is AAV2/8.

25. An isolated host cell transformed with the first viral vector of claim 24 .

26. A pharmaceutical composition comprising the first viral vector of claim 24 and pharmaceutically acceptable vehicle, optionally wherein the pharmaceutical composition is administered to a subject via subretinal administration.

27. A second polynucleotide comprising in a 5′-3′ direction:

a 5′-inverted terminal repeat (5′-ITR) sequence;

a nucleic acid sequence of a recombinogenic region;

a nucleic acid sequence of a splicing acceptor signal;

a 3′ end portion of a coding sequence of a gene of interest;

a poly-adenylation signal nucleic acid sequence; and

a 3′-inverted terminal repeat (3′-ITR) sequence,

wherein the ITRs are adeno-associated virus (AAV) ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:

(SEQ ID NO: 3)

GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA

AAAATTTAACGCGAATTTTAACAAAAT;

 or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto.

28. The second polynucleotide of claim 27 , capable of undergoing homologous recombination with a first polynucleotide that comprises the Fl phage recombinogenic region.

29. The second polynucleotide of claim 27 , wherein:

the nucleotide sequence of the 5′-ITR and 3′-ITR are obtained from an AAV of the same AAV serotype or a different AAV serotype;

the nucleotide sequence of the 5′-ITR and 3′-ITR are obtained from AAV serotype 2;

the coding sequence is split into the 3′ end portion at a natural exon-exon junction;

the nucleic acid sequence of the splicing acceptor signal comprises

(SEQ ID NO: 2)

GATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACA

G;

the 3′ end portion of the coding sequence of the gene of interest is 4.5 Kb, 5 Kb, 5.5 Kb, 6 Kb, or a smaller size; and/or

the coding sequence is a nucleotide sequence encoding a protein able to correct an inherited retinal degeneration, optionally wherein the coding sequence is selected from the group consisting of the gene coding sequences of: ABCA4, MYO7A, CEP290, CDH23, EYS, USH2a, GPR98, and ALMS1.

30. The second polynucleotide of claim 27 , wherein the poly-adenylation signal nucleic acid sequence comprises a bovine growth hormone (BGH) poly-adenylation signal or a simian virus 40 (SV40) poly-adenylation signal.

31. A second viral vector comprising the second polynucleotide of claim 27 , optionally wherein the vector is an AAV vector, optionally wherein:

the adeno-associated virus is selected from serotype 2, serotype 8, serotype 5, serotype 7, and serotype 9; and/or

the AAV vector is AAV2/8.

32. An isolated host cell transformed with the second viral vector of claim 31 .

33. A pharmaceutical composition comprising the second viral vector of claim 31 and pharmaceutically acceptable vehicle, optionally wherein the pharmaceutical composition is administered to a subject via subretinal administration.

34. A dual construct system to express a coding sequence of a gene of interest in a host cell, the coding sequence having a 5′ end portion and a 3′ end portion, the dual construct system comprising:

a) a first polynucleotide comprising in a 5′-3′ direction:

a 5′-inverted terminal repeat (5′-ITR) sequence;

a promoter sequence;

a 5′ end portion of the coding sequence of the gene of interest, the 5′ end portion being operably linked to and under control of the promoter sequence;

a nucleic acid sequence of a splicing donor signal;

a nucleic acid sequence of a recombinogenic region; and

a 3′-inverted terminal repeat (3′-ITR) sequence,

wherein the ITRs are adeno-associated virus (AAV) ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:

(SEQ ID NO. 3)

GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA

AAAATTTAACGCGAATTTTAACAAAAT;

 or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto; and

b) a second polynucleotide comprising in a 5′-3′ direction:

a 5′-inverted terminal repeat (5′-ITR) sequence;

a nucleic acid sequence of a recombinogenic region;

a nucleic acid sequence of a splicing acceptor signal;

a 3′ end portion of the coding sequence of the gene of interest;

a poly-adenylation signal nucleic acid sequence; and

a 3′-inverted terminal repeat (3′-ITR) sequence,

wherein the ITRs are AAV ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:

(SEQ ID NO. 3)

GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA

AAAATTTAACGCGAATTTTAACAAAAT;

 or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto.

35. The dual construct system of claim 34 , wherein upon introduction of the first polynucleotide and the second polynucleotide into the host cell, the coding sequence reconstitutes by means of the splicing donor and the splicing acceptor signals.

36. The dual construct system of claim 34 , wherein:

upon introduction of the first polynucleotide and the second polynucleotide into the host cell, the coding sequence reconstitutes by means of homologous recombination between the Fl phage recombinogenic region of the first polynucleotide and the Fl phage recombinogenic region of the second polynucleotide; or

upon introduction of the first polynucleotide and the second polynucleotide into the host cell, the coding sequence reconstitutes by means of ITR-mediated concatemerization; or

upon introduction of the first polynucleotide and the second polynucleotide into the host cell, the coding sequence reconstitutes by one or both of:

(i) ITR-mediated concatemerization; and

(ii) homologous recombination between the Fl phage recombinogenic region of the first polynucleotide and the Fl phage recombinogenic region of the second polynucleotide,

followed by splicing through the splicing donor and the splicing acceptor signals for the production of a mature mRNA.

37. The dual construct system of claim 34 , wherein:

the 3′-ITR of the first polynucleotide and the 5′-ITR of the second polynucleotide are from the same AAV serotype;

the 5′-ITR and 3′-ITR of the first polynucleotide and the 5′-ITR and 3′-ITR of the second polynucleotide are respectively from different AAV serotypes;

the 5′-ITR of the first polynucleotide and the 3′-ITR of the second polynucleotide are from different AAV serotypes;

the nucleotide sequence of the 5′-ITR and 3′-ITR of the first polynucleotide and the second polynucleotide are obtained from AAV serotype 2;

the coding sequence is split into the 5′ end portion and the 3′ end portion at a natural exon-exon junction;

the nucleic acid sequence of the splicing donor signal comprises the sequence:

(SEQ ID NO: 1)

GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGG

CTTGTCGAGACAGAGAAGACTCTTGCGTTTCT;

the nucleic acid sequence of the splicing acceptor signal comprises the sequence

(SEQ ID NO: 2)

GATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACA

G;

the 5′ end portion of the coding sequence of the gene of interest is 4.5 Kb, 5 Kb, 5.5 Kb, 6 Kb, or a smaller size;

the 3′ end portion of the coding sequence of the gene of interest is 4.5 Kb, 5 Kb, 5.5 Kb, 6 Kb, or a smaller size;

the first polynucleotide further comprises at least one enhancer and/or intron sequence, operably linked to the coding sequence; and/or

the coding sequence is a nucleotide sequence encoding a protein able to correct an inherited retinal degeneration, optionally wherein the coding sequence is selected from the group consisting of the gene coding sequences of: ABCA4, MYO7A, CEP290, CDH23, EYS, USH2a, GPR98, and ALMS1.

38. The dual construct system of claim 34 , wherein:

the promoter sequence is selected from the group consisting of a cytomegalovirus (CMV) promoter sequence, a chicken beta-actin (CBA) promoter sequence, a vitelliform macular dystrophy 2 (VMD2) promoter sequence, a interphotoreceptor retinoid binding protein promoter sequence, a rhodopsin (RHO) promoter sequence, and a rhodopsin kinase (RHOK) promoter sequence; and/or

the poly-adenylation signal nucleic acid sequence comprises a bovine growth hormone (BGH) poly-adenylation signal or a simian virus 40 (SV40) poly-adenylation signal.

39. A dual viral vector system comprising: a) a first viral vector containing the first polynucleotide, and b) a second viral vector containing the second polynucleotide, wherein said first and said second polynucleotides are as defined in claim 34 , and wherein the vectors are AAV vectors, optionally wherein:

the AAV vectors are the same or different AAV serotypes;

the AAV vectors have a serotype selected from the group consisting of serotype 2, serotype 8, serotype 5, serotype 7 and serotype 9;

the AAV vector is AAV2/8;

the dual viral vector system is capable of transducing one or both of retinal pigment epithelium and photoreceptors; and/or

the dual viral vector system is capable of inducing stronger expression of the gene of interest compared to a dual AAV trans-splicing vector system.

40. An isolated host cell transformed with the dual viral vector system according to claim 39 .

41. A pharmaceutical composition comprising the dual viral vector system of claim 39 , and a pharmaceutically acceptable vehicle, optionally wherein the pharmaceutical composition is administered to a subject via subretinal administration.

42. A method for treating a subject having a disease characterized by a retinal degeneration comprising subretinally administering to the subject an effective amount of the dual viral vector system of claim 39 , optionally wherein the disease characterized by a retinal degeneration is Usher 1B and the coding sequence is of a MYO7A gene.

43. A dual construct system to express a coding sequence of a gene of interest in an host cell, the coding sequence having a 5′ end portion and a 3′ end portion, the dual construct system comprising:

a) a first polynucleotide comprising in a 5′-3′ direction:

a 5′-inverted terminal repeat (5′-ITR) sequence;

a chicken beta-actin (CBA) promoter sequence;

a 5′ end portion of the coding sequence of a MYO7A gene, the 5′ end portion being operably linked to and under control of the promoter sequence;

a nucleic acid sequence of a splicing donor signal;

a nucleic acid sequence of a recombinogenic region; and

a 3′-inverted terminal repeat (3′-ITR) sequence,

wherein the ITRs are adeno-associated virus (AAV) ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:

(SEQ ID NO. 3)

GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA

AAAATTTAACGCGAATTTTAACAAAAT;

 or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto; and

b) a second polynucleotide comprising in a 5′-3′ direction:

a 5′-inverted terminal repeat (5′-ITR) sequence;

a nucleic acid sequence of a recombinogenic region;

a nucleic acid sequence of a splicing acceptor signal;

a 3′ end portion of the coding sequence of a MYO7A gene;

a bovine growth hormone (BGH) poly-adenylation signal nucleic acid sequence; and

a 3′-inverted terminal repeat (3′-ITR) sequence,

wherein the ITRs are AAV ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:

(SEQ ID NO. 3)

GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA

AAAATTTAACGCGAATTTTAACAAAAT;

 or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto.

44. The dual construct system of claim 43 , wherein:

upon introduction of the first polynucleotide and the second polynucleotide into the host cell, the coding sequence reconstitutes by means of the splicing donor and the splicing acceptor signals;

upon introduction of the first polynucleotide and the second polynucleotide into the host cell, the coding sequence reconstitutes by means of homologous recombination between the Fl phage recombinogenic region of the first polynucleotide and the Fl phage recombinogenic region of the second polynucleotide;

the 3′-ITR of the first polynucleotide and the 5′-ITR of the second polynucleotide are from the same AAV serotype;

the 5′-ITR and 3′-ITR of the first polynucleotide and the 5′-ITR and 3′-ITR of the second polynucleotide are respectively from different AAV serotypes;

the 5′-ITR of the first polynucleotide and the 3′-ITR of the second polynucleotide are from different AAV serotypes;

the nucleotide sequence of the 5′-ITR and 3′-ITR of the first polynucleotide and the second polynucleotide are obtained from AAV serotype 2;

the coding sequence is split into the 5′ end portion and the 3′ end portion at a natural exon-exon junction;

the MYO7A coding sequence is split between exons 24-25;

the nucleic acid sequence of the splicing donor signal comprises the sequence:

(SEQ ID NO: 1)

GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGG

CTTGTCGAGACAGAGAAGACTCTTGCGTTTCT;

the nucleic acid sequence of the splicing acceptor signal comprises the sequence

(SEQ ID NO: 2)

GATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACA

G;

 and/or

the first polynucleotide further comprises at least one enhancer and/or intron sequence, operably linked to the coding sequence.

45. A dual viral vector system comprising: a) a first viral vector containing the first polynucleotide, and b) a second viral vector containing the second polynucleotide, wherein said first and said second polynucleotides are as defined in claim 43 , and wherein the vectors are AAV vectors, optionally wherein:

the AAV vectors are the same or different AAV serotypes;

the AAV vectors have a serotype selected from the group consisting of serotype 2, serotype 8, serotype 5, serotype 7 and serotype 9; and/or

the AAV vector is AAV2/8.

46. The dual viral vector system of claim 45 ,

capable of transducing one or both of retinal pigment epithelium and photoreceptors;

capable of inducing stronger expression of MYO7A compared to a dual AAV trans-splicing vector system; and/or

capable of transducing retina to a higher level compared to an oversized AAV vector system or a dual viral vector system comprising an alkaline phosphatase (AP) recombinogenic region.

47. An isolated host cell transformed with the dual viral vector system according to claim 45 , optionally wherein the host cell is a human cell.

48. A pharmaceutical composition comprising the dual viral vector system of claim 45 , and a pharmaceutically acceptable vehicle, optionally wherein the pharmaceutical composition is administered to a subject via subretinal administration.

49. A method for treating a subject having Usher 1B, comprising subretinally administering to the subject an effective amount of the dual viral vector system of claim 45 .

50. A method for correctly localizing retinal pigment epithelium (RPE) melanosomes apically, comprising subretinally administering to the subject an effective amount of the dual viral vector system of claim 45 .

51. A method for reducing the accumulation of rhodopsin at the connecting cilium of photoreceptors, comprising subretinally administering to the subject an effective amount of the dual viral vector system of claim 45 .

52. A method to induce genetic recombination in a host cell, the method comprising introducing into the host cell a dual construct system, wherein the dual construct system comprises:

a) a first polynucleotide comprising in a 5′-3′ direction:

a 5′-inverted terminal repeat (5′-ITR) sequence;

a promoter sequence;

a 5′ end portion of a coding sequence of a gene of interest, the 5′ end portion being operably linked to and under control of the promoter sequence;

a nucleic acid sequence of a splicing donor signal;

a nucleic acid sequence of a recombinogenic region; and

a 3′-inverted terminal repeat (3′-ITR) sequence,

wherein the ITRs are adeno-associated virus (AAV) ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:

(SEQ ID NO. 3)

GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA

AAAATTTAACGCGAATTTTAACAAAAT;

 or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto; and

b) a second polynucleotide comprising in a 5′-3′ direction:

a 5′-inverted terminal repeat (5′-ITR) sequence;

a nucleic acid sequence of a recombinogenic region;

a nucleic acid sequence of a splicing acceptor signal;

a 3′ end portion of a coding sequence of the gene of interest;

a poly-adenylation signal nucleic acid sequence; and

a 3′-inverted terminal repeat (3′-ITR) sequence,

wherein the ITRs are AAV ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:

(SEQ ID NO. 3)

GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA

AAAATTTAACGCGAATTTTAACAAAAT;

 or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto.

53. The method of claim 52 , wherein:

upon introduction of the first polynucleotide and the second polynucleotide into the host cell, the coding sequence reconstitutes by means of the splicing donor and the splicing acceptor signals; and/or

upon introduction of the first polynucleotide and the second polynucleotide into the host cell, the coding sequence reconstitutes by means of homologous recombination between the Fl phage recombinogenic region of the first polynucleotide and the Fl phage recombinogenic region of the second polynucleotide.

54. A method for reconstituting a coding sequence in a host cell, the method comprising introducing into the host cell a dual construct system, wherein the dual construct system comprises:

a) a first polynucleotide comprising in a 5′-3′ direction:

a 5′-inverted terminal repeat (5′-ITR) sequence;

a promoter sequence;

a 5′ end portion of a coding sequence of a gene of interest, the 5′ end portion being operably linked to and under control of the promoter sequence;

a nucleic acid sequence of a splicing donor signal;

a nucleic acid sequence of a recombinogenic region; and

a 3′-inverted terminal repeat (3′-ITR) sequence,

wherein the ITRs are adeno-associated virus (AAV) ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:

(SEQ ID NO. 3)

GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA

AAAATTTAACGCGAATTTTAACAAAAT;

 or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto; and

b) a second polynucleotide comprising in a 5′-3′ direction:

a 5′-inverted terminal repeat (5′-ITR) sequence;

a nucleic acid sequence of a recombinogenic region;

a nucleic acid sequence of a splicing acceptor signal;

a 3′ end portion of a coding sequence of the gene of interest;

a poly-adenylation signal nucleic acid sequence; and

a 3′-inverted terminal repeat (3′-ITR) sequence,

wherein the ITRs are AAV ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:

(SEQ ID NO. 3)

GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA

AAAATTTAACGCGAATTTTAACAAAAT;

 or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto.

55. A dual viral vector system comprising:

a) a first viral vector comprising in a 5′-3′ direction:

a 5′-inverted terminal repeat (5′-ITR) sequence;

a promoter sequence;

a 5′ end portion of a coding sequence of a gene of interest, the 5′ end portion being operably linked to and under control of the promoter sequence;

a nucleic acid sequence of a splicing donor signal;

a nucleic acid sequence of a recombinogenic region; and

a 3′-inverted terminal repeat (3′-ITR) sequence,

wherein the ITRs are adeno-associated virus (AAV) ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:

(SEQ ID NO. 3)

GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA

AAAATTTAACGCGAATTTTAACAAAAT;

 or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto; and

b) a second viral vector comprising in a 5′-3′ direction:

a 5′-inverted terminal repeat (5′-ITR) sequence;

a nucleic acid sequence of a recombinogenic region;

a nucleic acid sequence of a splicing acceptor signal;

a 3′ end portion of a coding sequence of the gene of interest;

a poly-adenylation signal nucleic acid sequence; and

a 3′-inverted terminal repeat (3′-ITR) sequence,

wherein the ITRs are AAV ITRs, and wherein the recombinogenic region is: (a) a Fl phage recombinogenic region that consists of the sequence:

(SEQ ID NO. 3)

GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA

AAAATTTAACGCGAATTTTAACAAAAT;

 or (b) a fragment of SEQ ID NO: 3 having at least 85% sequence identity thereto.

Assignments (2)
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Dec 2, 2024
From: AURICCHIO, ALBERTO; COLELLA, PASQUALINA; TRAPANI, IVANA
To: FONDAZIONE TELETHON
Reel/Frame 069447/0455 →
CHANGE OF NAME Recorded Dec 2, 2024
From: FONDAZIONE TELETHON
To: FONDAZIONE TELETHON ETS
Reel/Frame 069466/0896 →
Continuity (2)
Provisional Application 61813342 · Apr 18, 2013
Reissue 14785229 · Apr 18, 2014
References Cited (187)
US 5166331A · Della Valle et al. · 1992 [cited by applicant]
US 6255071B1 · Beach · 2001 [cited by examiner]
US 6399587B1 · Mehtali et al. · 2002 [cited by applicant]
US 6808922B1 · Bebbington · 2004 [cited by examiner]
US 6846970B1 · Christou · 2005 [cited by examiner]
US 7250406B2 · Tang · 2007 [cited by examiner]
US 8394604B2 · Liu et al. · 2013 [cited by applicant]
US 10214572B2 · Boye et al. · 2019 [cited by applicant]
US 10494645B2 · Auricchio et al. · 2019 [cited by applicant]
US 20040142884A1 · Tang et al. · 2004 [cited by applicant]
US 20050101582A1 · Lyons et al. · 2005 [cited by applicant]
US 20050181017A1 · Hughes et al. · 2005 [cited by applicant]
US 20050250737A1 · Hughes et al. · 2005 [cited by applicant]
US 20050281861A1 · Hughes et al. · 2005 [cited by applicant]
US 20060105953A1 · Lacoste et al. · 2006 [cited by applicant]
US 20060141049A1 · Lyons et al. · 2006 [cited by applicant]
US 20060182783A1 · Hughes et al. · 2006 [cited by applicant]
US 20070059336A1 · Hughes et al. · 2007 [cited by applicant]
US 20070224278A1 · Lyons et al. · 2007 [cited by applicant]
US 20080241252A1 · Lyons et al. · 2008 [cited by applicant]
US 20090149435A1 · Wang et al. · 2009 [cited by applicant]
US 20090215172A1 · Schnidt et al. · 2009 [cited by applicant]
US 20090082321A1 · Edelman et al. · 2009 [cited by applicant]
US 20100003218A1 · Duan et al. · 2010 [cited by applicant]
US 20100209414A1 · Schmidt et al. · 2010 [cited by applicant]
US 20140256802A1 · Boye · 2014 [cited by examiner]
US 20160076054A1 · Auricchio et al. · 2016 [cited by applicant]
US 20180327779A1 · Colella et al. · 2018 [cited by applicant]
US 20210371878A1 · Auricchio et al. · 2021 [cited by applicant]
US 20220002749A1 · Colella et al. · 2022 [cited by applicant]
US 20220389450A1 · Auricchio et al. · 2022 [cited by applicant]
CA 2909733A1 · 2014 [cited by applicant]
CN 1279723A · 2001 [cited by applicant]
CN 102282255A · 2011 [cited by applicant]
EP 0356130A2 · 1990 [cited by applicant]
EP 3265571B1 · 2018 [cited by applicant]
JP H02124094A · 1990 [cited by applicant]
JP 2002511751A · 2002 [cited by applicant]
JP 2007209227A · 2007 [cited by applicant]
JP 2012531191A · 2011 [cited by applicant]
WO WO1999015683A1 · 1999 [cited by applicant]
WO WO1999041397A1 · 1999 [cited by applicant]
WO WO2001029243A1 · 2001 [cited by applicant]
WO WO2001079518A2 · 2001 [cited by applicant]
WO WO2004025264A2 · 2004 [cited by applicant]
WO 2008106644 · 2008 [cited by applicant]
WO WO2008106644A2 · 2008 [cited by applicant]
WO 2009103562 · 2009 [cited by applicant]
WO WO2009103562A1 · 2009 [cited by applicant]
WO WO2010048086A1 · 2010 [cited by applicant]
WO WO2010059763A1 · 2010 [cited by applicant]
WO WO2011000929A1 · 2011 [cited by applicant]
WO WO2013045632A1 · 2013 [cited by applicant]
WO 2013075008 · 2013 [cited by applicant]
WO WO2013075008A1 · 2013 [cited by applicant]
WO WO2014170480A1 · 2014 [cited by applicant]
WO WO2015054653A2 · 2015 [cited by applicant]
WO WO2015121501A1 · 2015 [cited by applicant]
WO WO2016139321A1 · 2016 [cited by applicant]
WO WO2016146757A1 · 2016 [cited by applicant]
WO WO2017019994A2 · 2017 [cited by applicant]
WO WO2017132580A2 · 2017 [cited by applicant]
WO WO2017216560A1 · 2017 [cited by applicant]
WO WO2018071868A1 · 2018 [cited by applicant]
WO WO2018160582A1 · 2018 [cited by applicant]
Esposito et al., Liver gene therapy with intein-mediated F8 thans-splicing corrects mouse Haemophilia A, EMBO Molecular Medicine, 2022, 14: e15199. [cited by applicant]
Padula et al., Full-length ATP7B reconstituted through protein trans-splicing corrects Wolson disease in mice, Molecular Therapy: Methods and Clinicla Development, Sep. 2022, 26: 495-504. [cited by applicant]
Tornabene et al., 240. Inclusion of a degron reduces levels of undesired inteins after AAV-mediated protein trans-splicing in the retina, Molecular Therapy, New Technologies Advancing Gene Therapy for Neurologic Disease… [cited by applicant]
Tornabene et al., 931. Selective Intein Degradation for safe AAV Mediated Large Gene Delivery, Molecular Therapy, New Techniques in Gene Therapy for Neurologic Disorders, Apr. 28, 2020, 28(4S1): 402-403 (Abstract). [cited by applicant]
Tornabene et al., Inclusion of a degron reduces levels of undesired inteins after AAV-mediated protein trans-splicing in the retina, Mol Ther.: Methods and Clinical Development, Dec. 2021, 23: 448-459. [cited by applicant]
Tornabene et al., Intein-mediated protein trans-splicing expands adeno-associated virus transfer capacity in the retina, Sci Transl Med., May 15, 2019, 11(492): 1-30. [cited by applicant]
Hill et al., “Nucleotide Sequence of Bacteriophage f1 DNA”, [cited by applicant]
International Search Report for International Patent Application No. PCT/EP2014/058000, mailed Jul. 21, 2014, 5 pages. [cited by applicant]
Allikmets R., A photoreceptor cell-specific ATP-binding transporter gene (ABCR) is mutated in recessive Stargardt macular dystrophy, Nature Genetics, 1997, vol. 15(3) pp. 236-246 & Erratum published in Nature Genetics. … [cited by applicant]
Auricchio A et al, Exchange of surface proteins impacts on viral vector cellular specificy and transduction characteristics: the retina as a model. (2001) Human Molecular Genetics., 10(26):3075-3081. [cited by applicant]
Auricchio, A. J. Smith, R. R. Ali, The Future Looks Brighter After 25 Years of Retinal Gene Therapy, Human Gene Therapy, 2017, vol. 28(11), pp. 982-987. [cited by applicant]
Bennicelli J, et al Mol Ther. Jan. 22, 2008; Reversal of Blindness in Animal Models of Leber Congenital Amaurosis Using Optimized AAV2-mediated Gene Transfer, Mar. 2008, vol. 16, No. 3, pp. 458-465. [cited by applicant]
Bothwell et al. (1981) Heavy chain variable region contribution to the NPb family of antibodies: somatic mutation evident in a γ2a variable region, Cell 24, pp. 625-637. [cited by applicant]
Bungert S, L. L. Molday, R. S. Molday, Membrane topology of the ATP binding cassette transporter ABCR and its relationship to ABC1 and related ABCA transporters: identification of N-linked glycosylation sites, J Biol Ch… [cited by applicant]
Bunting, S., et al., Gene Therapy with BMN 270 Results in Therapeutic Levels of FVIII in Mice and Primates and Normalization of Bleeding in Hemophilic Mice. Mol Ther, 2018. 26(2): p. 496-509. [cited by applicant]
Cheriyan M, S. H. Chan, F. Perler, Traceless splicing enabled by substrate-induced activation of the Nostoc punctiforme Npu DnaE intein after mutation of a catalytic cysteine to serine, J Mol Biol 426(24), 4018-4029 (20… [cited by applicant]
Cho et al., A degron created by SMN2 exon 7 skipping is a principal contributor to spinal muscular atrophy severity, Genes and Development, Mar. 1, 2010, 24(5): 438-442. [cited by applicant]
Colella P et al., “Efficient gene delivery to the cone-enriched pig retina by dual AAV vectors”, Gene Therapy, Apr. 1, 2014, vol. 21 No. 4, pp. 450-456 XP055270423 https://www.nature.com/articles/gt20148. [cited by applicant]
Dalkara D et al., In vivo-directed evolution of a new adeno-associated virus for therapeutic outer retinal gene delivery from the vitreous, Sci Transl Med. Jun. 12, 2013;5(189):189ra76. [cited by applicant]
Devereux J et al., A comprehensive set of sequence analysis programs for the VAX, Nucl. Acid Res., 12:387-395 (1984). [cited by applicant]
Donello J E, J. E. Loeb, T. J. Hope, Woodchuck hepatitis virus contains a tripartite posttranscriptional regulatory element, J Virol 72, 5085-5092 (1998). [cited by applicant]
Doria M, A. Ferrara, A. Auricchio, AAV2/8 vectors purified from culture medium with a simple and rapid protocol transduce murine liver, muscle, and retina efficiently, Hum Gene Ther Methods 24 (6), 392-398 (2013). [cited by applicant]
Drivas T G., E. L. Holzbaur, J. Bennett, Disruption of CEP290 microtubule/membrane-binding domains causes retinal degeneration, J Clin Invest 123(10), 4525-4539 (2013). [cited by applicant]
Duan et al., Expanding AAV Packaging Capacity with Trans-slicing or Overlapping Vectors: A Quantitiative Comparison, the Journal of the American Society of Gene Therapy, vol. 4, No. 4, pp. 383-391 (2001). [cited by applicant]
Dyka F M et al., Dual adeno-associated virus vectors result in efficient in vitro and in vivo expression of an Oversized Gene, MYO7A, Human Gene Therapy Methods, Apr. 1, 2014, vol. 25, No. 2, pp. 166-177. [cited by applicant]
Esumi N, et al., Analysis of the VMD2 Promoter and Imlications of E-box Binding Factors in its Regulation, J. Biol. Chem. vol. 279, No. 18, pp. 19064-19073 (2004). [cited by applicant]
FDA approves hereditary blindness gene therapy. Nat Biotechnol 36, 6 (2018). [cited by applicant]
Flotte TR. Adeno-associated virus-based gene therapy for inherited disorders. Pediatr Res. Dec. 2005;58(6):1143-7. [cited by applicant]
Gao G et al., Purification of recombinant adeno-associated virus vectors by column chromatography and its performance in vivo, Human Gene Therapy, 2000, 11(15), 2079-2091. [cited by applicant]
Ghosh et al. (2008), A hybrid vector system expands adeno-associated viral vector packaging capacity in a transgene-independent manner, Molecular Therapy Jan. 2008, 16(1): 124-130. [cited by applicant]
Gibbs D, et al., Function of MYO7A in the Human RPE and the Validity of Shaker1 Mice as a Model for Usher Syndrome 1B, Invest. Ophthalmol. Vis. Sci. 2010, 51, 1130-1135. [cited by applicant]
Gilon et al., Degradation signals for ubiquitin system proteolysis in [cited by applicant]
Goncalves MA. Adeno-associated virus: from defective virus to effective vector, Virol J. May 6, 2005;2:43-60. [cited by applicant]
Grimm et al. (1998) Novel Tools for Production and Purification of Recombinant Adeno associated Virus Vectors, Hum. Gene Ther, pp. 2745-2760. [cited by applicant]
Hasson T et al., Expression in cochlea and retina of myosin VIIa, the gene product defective in Usher syndrome type 1B, Proc. Natl Acad Sci USA, 1995, vol. 92, 9815-9819. [cited by applicant]
Hickey DG et al., Tropism of engineered and evolved recombinant AAV serotypes in the rd1 mouse and ex vivo primate retina, Gene Therapy Dec. 2017;24(12):787-800. [cited by applicant]
International Search Report and Written Opinion for PCT International Patent Application No. PCT/EP2016/054602, mailed Jul. 20, 2016. [cited by applicant]
International Search Report and Written Opinion for PCT International Patent Application No. PCT/EP2019-078020, mailed May 14, 2020. [cited by applicant]
Iwai H, S. Zuger, J. Jin, P. H. Tam, Highly efficient protein trans-splicing by a naturally split DnaE intein from Nostoc punctiforme, FEBS Letters, 2006, 580(7), pp. 1853-1858. [cited by applicant]
Iwamoto M et al., A general chemical method to regulate protein stability in the mammalian central nervous system, Chem Biol. Sep. 24, 2010; 17(9): 981-988. [cited by applicant]
Jansen M et al., Role of ORPs in sterol transport from plasma membrane to ER and lipid droplets in mammalian cells, Traffic 2011, vol. 12(2), pp. 218-231. [cited by applicant]
Karlin S and Altschul S F, Applications and statistics for multiple high-scoring segments in meolcular sequences, Proc Natl Acad Sci USA, Jun. 1993, vol. 90, pp. 5873-5877. [cited by applicant]
Karlin S and Altschul S F, Methods for assessing the statistical significant of molecular sequence features by using general scoring schemes, Proc Natl Acad Sci USA, 1990, vol. 87, pp. 2264-2268. [cited by applicant]
Khani S C et al., AAV-mediated expression targeting of rod and cone photoreceptors with a human rhodopsin kinase promoter, Invest Ophthalmol Vis Sci, vol. 48(9), pp. 3954-3961 (2007). [cited by applicant]
Klimczak R R et al., A novel adeno-associated viral variant for efficient and selective intravitreal transduction of rat Müller cells, PLoS One. Oct. 14, 2009;4(10):e7467. [cited by applicant]
Levitt N et al., Definition of an efficient synthetic poly(A) site. Genes Dev. Jul. 1989;3(7):1019-1025. [cited by applicant]
Li et al “Protein Trans-Splicing as a means for viral vector-mediated in vivo gene therapy”, Human Gene Therapy, Sep. 1, 2008, vol. 19, No. 9, pp. 958-964. [cited by applicant]
Li Y, Split-inteins and their bioapplications , Biotechnol Letters, 2015, 37, 2121-2137. [cited by applicant]
Liang F-Q et al. (2000) Intraocular Delivery of Recombinant Virus, in Methods in Molecular Medicine, vol. 47: Vision Research Protocols edited by P E Rakoczy, Humana Press, V pp. 125-139. [cited by applicant]
Lilley, D.M. and Dahlberg, J.E. (1992) Methods in Enzymology: DNA Structures Part A: Synthesis and Physical Analysis of DNA, Academic Press. [cited by applicant]
Liu X Q et al., A DnaB intein in Rhodothermus marinus: Indication of recent intein homing across remotely related organisms, Proc Natl Acad Sci USA, Jul. 22, 1997;94(15):7851-6. [cited by applicant]
Liu X, et al. Myosin Vlla, the product of the Usher 1B syndrome gene, is concentrated in the connecting cilia of photoreceptor cells, Cell. Motil. Cytoskeleton, 1997, 37, 240-252 (1997). [cited by applicant]
Liu Y-L et al.(2003) Optimized Production of High-Titer Recombinant Adeno-associated Virus in Roller Bottles, Biotechniques 34(1): 184-189. [cited by applicant]
Lockless S W, T. W. Muir, Traceless protein splicing utilizing evolved split inteins, Proc Natl Acad Sci USA, 2009, vol. 106, pp. 10999-11004. [cited by applicant]
Lostal et al., Full-Length Dystrophin Reconstitution with Adeno-Associated Viral Vectors, Human Gene Therapy, Jun. 2014, 25: 552-562. [cited by applicant]
Ma S L et al. (2015) Whole Exome Sequencing Reveals Novel PHEX Splice Site Mutations in Patients with Hypophosphatemic Rickets, PLoS One 10(6): p. e0130729. [cited by applicant]
Maddalena S et al., Triple Vectors Expand AAV Transfer Capacity in the Retina, Mol Ther 2018, vol. 26, pp. 524-541. [cited by applicant]
Madeira F et al., (2019) The EMB:-EBI search and seqeunce analysis tools API in 2019. Nucleic Acids Research, 47(W1), pp. W636-W641. [cited by applicant]
Mandel RJ, Manfredsson FP, Foust KD, Rising A, Reimsnider S, Nash K, Burger C. Recombinant adeno-associated viral vectors as therapeutic agents to treat neurological disorders. Mol Ther. Mar. 2006;13(3):pp. 463-483. [cited by applicant]
Mata N L et al., Invest Ophthalmol Vis Sci, 2001, vol. 42, pp. 1685-1690. [cited by applicant]
McIntosh J et al., Therapeutic levels of FVIII following a single peripheral vein administration of rAAV vector encoding a novel human factor VIII variant, Blood Feb. 20, 2013, 121(17):3335-3344. [cited by applicant]
Millan J M, et al., An update on the genetics of usher syndrome, J. Ophthalmol. 2011, vol. 2011, 417217. [cited by applicant]
Mills K V, M. A. Johnson, F. B. Perler, Protein Splicing: How Inteins Escape from Precursor Proteins, J Biol Chem 289, 2014, 14498-14505. [cited by applicant]
Mussolino C et al., AAV-mediated photoreceptor transduction of the pig cone-enriched retina, Gene Ther 2011, vol. 18, pp. 637-645. [cited by applicant]
Nakano T et al., Self-formation of optic cups and storable stratified neural retina from human ESCs , Cell Stem Cell 2012, vol. 10, pp. 771-785. [cited by applicant]
Nathwani A C et al. (2006) Self-complementary adeno-associated virus vectors containg a novel liver-specific human factor OX expression cassette enable highly efficient transduction of murine and non-human primate liver… [cited by applicant]
NIH National Library of Medicine, Bacteriophage f1, complete genome, GenBank Database Accession No. J02448.1, Apr. 27, 1993. [cited by applicant]
NIH National Library of Medicine, luciferase luc2CP [Firefly luciferase reporter vector pGL4.12[luc2CP]], GenBank Database Accession No. AAV52873.1, Nov. 8, 2004. [cited by applicant]
Novikova O, N. Topilina, M. Belfort, J Biol Chem 2014, 289, pp. 14490-14497. [cited by applicant]
Panda-Jonas et al., Retinal Photoreceptor Count, Retinal Surface Area, and Optic Disc Size in Normal Human Eyes, Opthamology, Mar. 1994, 101(3): 519-523. [cited by applicant]
Pellissier L P et al., Specific tools for targeting and expression in Müller glial cells. Mol Ther Methods Clin Dev., 2014, vol. 1, 14009. [cited by applicant]
Perler B et al., Protein splicing and autoproteolysis mechanisms, Mechanisms, 1997, pp. 292-299. [cited by applicant]
Perler, F. B. InBase, the Intein Database. Nucleic Acids Res., 2002, vol. 30, pp. 383-384. [cited by applicant]
Petrs-Silva H et al., Novel Properties of Tyrosine-mutant AAV2 Vectors in the Mouse Retina, Mol Ther. Feb. 2011;19(2):293-301. [cited by applicant]
Pietrokovski S, Conserved sequence features of inteins (protein introns) and their use in identifying new inteins and related proteins, Protein Science, 1994, vol. 3, issue 12, pp. 2340-2350. [cited by applicant]
Pietrokovski S, Modular organization of inteins and C-terminal autocatalytic domains, Protein Science vol. 7 No. 1, pp. 64-71. [cited by applicant]
Rangarajan, S., et al., AAV5-Factor VIII Gene Transfer in Severe Hemophilia A. N Engl J Med, 2017. 377(26): p. 2519-2530. [cited by applicant]
Reich S J, et al. Efficient trans-splicing in the retina expands the utility of adeno-associated virus as a vector for gene therapy, Human Gene Therapy, 2003, 14(1), 37-44. [cited by applicant]
Remtulla et al., A schematic eye for the mouse, and comparisons with the rat, Vision Research, 1985, 25(1): 21-31. [cited by applicant]
Salvetti et al. (1998) Factors Influencing Recombinant Adeno-Associated Virus Production, Hum. Gene Ther. 9, pp. 695-706. [cited by applicant]
Sangermano R et al., Photoreceptor Progenitor mRNA Analysis Reveals Exon Skipping Resulting from the ABCA4 c.5461-10T-→C Mutation in Stargardt Disease, Ophthalmology, 2016, vol. 123, pp. 1375-1385. [cited by applicant]
Schmelas C, D. Grimm, Split Cas9, Not Hairs—Advancing the Therapeutic Index of CRISPR Technology, Biotechnol J., 2018, vol. 13(9), e1700432. [cited by applicant]
Shah N H, et al., Extein Residues Play an Intimate Role in the Rate-Limiting Step of Protein Trans-Splicing, J Am Chem Soc 135, 5839-5847 (2013). [cited by applicant]
Shah N H, T. W. Muir, Inteins: nature's gift to protein chemists, Chem Sci, 2014) vol. 5, pp. 446-461. [cited by applicant]
Smith A J et al., Gene supplementation therapy for recessive forms of inherited retinal dystrophies, Gene Ther. Feb. 2012;vol. 19(2):pp. 154-161. [cited by applicant]
Sohocki M. M., et al. Prevalence of mutations causing retinitis pigmentosa and other inherited retinopathies, Hum. Mutat. 2001, vol. 17, pp. 42-51. [cited by applicant]
Srivastava A, In vivo tissue-tropism of adeno-associated viral vectors, Curr Opin Virol. Dec. 2016;vol. 21 pp. 75-80. [cited by applicant]
Stevens et al., Design of a Split Intein with Exceptional Protein Splicing Activity, J Am Chem Soc. Feb. 24, 2016; 138(7):2162-5. [cited by applicant]
Subramanyam P et al., Manipulating L-type calcium channels in cardiomyocytes using split-intein protein transsplicing, Proc Natl Acad Sci, 2013, vol. 110(38) pp. 15461-15466. [cited by applicant]
Sun H, P. M. Smallwood, J. Nathans, Biochemical defects in ABCR protein variants associated with human retinopathies., Nat Genet, 2000, vol. 26, pp. 242-246. [cited by applicant]
Surace EM, Auricchio A. Adeno-associated viral vectors for retinal gene transfer. Prog Retin Eye Res. Nov. 2003;22(6):705-19. [cited by applicant]
Tatusova T A et al., BLAST 2 Sequences, a new tool for comparing protein and nucleotide sequences, FEMS Microbiol. Lett., 1999, vol. 174, No. 2, p. 247-250. [cited by applicant]
Tatusova T A et al., Erratum to BLAST 2 Sequences, a new tool for comparing protein and nucleotide sequences, FEMS Microbiol. Lett., 1999, vol. 177, No. 1, p. 187-188. [cited by applicant]
Trapani et al., Improved dual AAV vectors with reduced expression of truncated proteins are safe and effective in the retina of a mouse model of Stargardt disease, Human Molecular Genetics, Sep. 29, 2015, 24(23): 6811-6… [cited by applicant]
Trapani I, A. Auricchio, Seeing the Light after 25 Years of Retinal Gene Therapy, Trends Mol Med., 2018, vol. 24(8) pp. 669-681. [cited by applicant]
Tsybovsky Y, K. Palczewski, Expression, purification and structural properties of ABC transporter ABCA4 and its individual domains, Protein Expr Purif, 2014, vol. 97, pp. 50-60. [cited by applicant]
U.S. Appl. No. 60/519,237 entitled “Compositions and methods for treating a posterior segment of an eye”, filed Nov. 12, 2003. [cited by applicant]
U.S. Appl. No. 60/567,423 entitled “Sustained release intraocular implants and related methods”, filed Apr. 30, 2004. [cited by applicant]
U.S. Appl. No. 60/630,062 entitled “Compositions and methods for treating a posterior segment of an eye”, filed Dec. 16, 2003. [cited by applicant]
U.S. Appl. No. 60/721,600 entitled “Anti-angiogenic sustained release intraocular implants and related methods”, filed Sep. 28, 2005. [cited by applicant]
Villiger L et al., Treatment of a metabolic liver disease by in vivo genome base editing in adult mice, Nat Med., 2018, vol. 24, pp. 1519-1525. [cited by applicant]
Weng J et al., Insights into the function of Rim protein in photoreceptors and etiology of Stargardt's disease from the phenotype in abor knockout mice, Cell, 1999, vol. 98, pp. 13-23. [cited by applicant]
Wu Z et al. (2008) Optimization of self-complementary AAV Vectors for Liver-directed Expression Results in Sustained Correction of Hemophilia B at Low Vector Dose., Mol. Ther. 16: 280-289. [cited by applicant]
Yan Z, Y. et al., Trans-splicing vectors expand the utility of adeno-associated virus for gene therapy, Proc Natl Acad Sci USA, 2000, vol. 97, pp. 6716-6721. [cited by applicant]
Zettler J, V. Schutz, H. D. Mootz, The naturally split Npu DnaE intein exhibits an extraordinarily high rate in the protein trans-splicing reaction, FEBS Letters, 2009, vol. 583, pp. 909-914. [cited by applicant]
Zhang N et al., Protein misfolding and the pathogenesis of ABCA4-associated retinal degenerations, Hum Mol Genet., 2015, vol. 24, pp. 3220-3237. [cited by applicant]
Zhong X et al., Generation of three-dimensional retinal tissue with functional photoreceptors from human iPSCs, Nature Communications, 2014, vol. 5, 4047. [cited by applicant]
Zhu F et al., Inter-chain disulfide bond improved protein trans-splicing increases plasma coagulation activity in C57BL/ mice following portal vein FVIII gene delivery by dual vectors, Science China Life, 2013, vol. 56(… [cited by applicant]
Zhu F et al,, Protein trans-splicing based dual-vector delivery of the coagulation factor VIII gene, Science China Life Sciences, 2010, vol. 53(6) pp. 683-689. [cited by applicant]
Zolotukhin S et al., (1999) Recombinant adeno-associated virus purification using novel methods improves infection titer and yield, Gene Ther. 6: 973-985. [cited by applicant]
U.S. Appl. No. 14/785,229, filed Apr. 18, 2014, U.S. Pub. No. 2016/0076054, Dec. 3, 2019, U.S. Pat. No. 10,494,645, Dec. 3, 2019, Alberto Auricchio, Effective Delivery Of Large Genes By Dual AAV Vectors. [cited by applicant]
U.S. Appl. No. 15/555,479, filed Mar. 3, 2016, U.S. Pub. No. 2018/0327779, Nov. 15, 2018, Pasqualina Colella, Multiple Vector System And Uses Thereof. [cited by applicant]
U.S. Appl. No. 17/202,098, filed Mar. 15, 2021, U.S. Pub. No. 2022/0002749, Jan. 6, 2022, Pasqualina Colella, Multiple Vector System and Uses Thereof. [cited by applicant]
U.S. Appl. No. 17/285,356, filed Oct. 15, 2019, U.S. Pub. No. 2021/0371878, Dec. 2, 2021, Alberto Auricchio, Intein Proteins And Uses Thereof. [cited by applicant]
U.S. Appl. No. 17/742,924, filed May 12, 2022, U.S. Pub. No. 2022/0389450, Dec. 8, 2022, Alberto Auricchio, Vector System. [cited by applicant]
Ghosh et al., “Efficient Transgene Reconstrutition with Hybrid Dual AAV Vectors Carrying the Minimized Bridging Sequences,” Human Gene Therapy, Jan. 2011, 11: 77-83. [cited by applicant]
Fujimoto et al., “Minimum Length of Homology Arms Required for Effective Red/ET Recombination”, Bioscience, Biotechnology, and Biochemistry, Dec. 23, 2009, 73(12): 2783-2786. [cited by applicant]
Powell et al., “Viral expression cassette elements to enhance transgene target specificity and expression in gene therapy”, Discov Med., Jan. 2015, 19(102): 49-57. [cited by applicant]
Rubnitz et al., “The minimum amount of homology required for homologous recombination in mammalian cells”, Molecular and Cellular Biology, Nov. 1984, 4(11): 2253-2258. [cited by applicant]
Lopes et al., “Retinal gene therapy with a large MY07A cDNA using adeno-associated virus”, Gene Therapy, vol. 20, No. 8, Jan. 24, 2013, pp. 824-833. [cited by applicant]
Trapan et al., “Effective delivery of large genes to the retina by dual AAV vectors”, EMBO Molecular Medicine, vol. 6, No. 2, Dec. 2013, pp. 194-211. [cited by applicant]
McClements et al., “Gene therapy for retinal disease”, Transitional Research, vol. 161, No. 4, Apr. 2013, pp. 241-254. [cited by applicant]