Granted Patent B2

US 12,594,301 · App. 17/762,690 · Granted Apr 7, 2026

Inventors: Jason Michael Gehrke (Cambridge, MA); Aaron D. Edwards (Cambridge, MA); Ryan Murray (Cambridge, MA); Waseem Qasim (London, GB)

Assignees: Beam Therapeutics Inc.; UCL BUSINESS LTD.

A61K35/12A61K40/11A61K40/22A61K40/31A61K40/418A61K40/4215A61K40/4224C07K16/1271C07K16/2803C12N5/0636A61K2035/122A61K2035/124A61K2239/48

Abstract

Claims (16)

1 . A method for producing a CD7 CAR-expressing immune cell or population of CAR-expressing immune cells having reduced immunogenicity, the method comprising

a) contacting a target polynucleotide in an immune cell or population of immune cells with a guide polynucleotide and a base editor comprising a fusion protein comprising a nucleic acid programmable DNA binding protein (napDNAbp) and a deaminase domain or a base editor system comprising a guide polynucleotide and a nucleic acid programmable DNA binding protein (napDNAbp) and a deaminase domain;

b) introducing by nucleobase modification a mutation that reduces or eliminates the expression of a CD7 antigen into the immune cell or the population of immune cells;

c) introducing by nucleobase modification a mutation that reduces or eliminates the expression of at least one polypeptide selected from the group consisting of CD3e, TRAC, LAG-3, FAS, CIITA, TRBC1, TRBC2, CD52, B2M, and PDC1/PD-1 into the immune cells or the population of immune cells; and

d) expressing in the immune cell or population of immune cells a chimeric antigen receptor that targets the CD7 antigen thereby producing a CAR-expressing immune cell or population of CAR-expressing immune cells having reduced immunogenicity, wherein the chimeric antigen receptor that targets the CD7 antigen comprises or consists of SEQ ID NO: 113.

2 . The method of claim 1 , wherein the immune cell or the population of immune cells produced by the method exhibits fratricide resistance and/or increased anti-neoplasia activity as compared to a corresponding control cell.

3 . The method of claim 1 wherein the immune cell or the population of immune produced by the method comprises no detectable translocations.

4 . The method of claim 1 , wherein the immune cell or the population of immune cells produced by the method comprises less than 1% indels.

5 . The method of claim 1 , wherein the immune cell or the population of immune cells produced by the method comprises less than 5% of non-target edits.

6 . The method of claim 1 , wherein the mutation is in an exon, in a splice donor site or a splice acceptor site.

7 . The method of claim 6 , wherein the mutation results in a premature stop codon that reduces or eliminates protein expression.

8 . The method of claim 1 , wherein the mutation reduces A expression of an encoded polypeptide by at least 50% or more relative to a corresponding control cell lacking the mutation.

9 . The method of claim 1 , wherein the guide polynucleotide comprises a nucleic acid sequence selected from CUCUUACCUGUACCAUAACC (SEQ ID NO: 1155), CCUACCUGUCACCAGGACCA (SEQ ID NO: 1128), and CACCUACCUAAGAACCAUCC (SEQ ID NO: 897).

10 . The method of claim 1 , wherein the guide polynucleotide targets the napDNAbp to a gene encoding CD3e, CD5, FAS, LAG-3, CD52, TRAC, B2M, CITA, TRBCI, TRBC2 or PDC1/PD-1, or a regulatory element thereof.

11 . The method of claim 1 , wherein the base editor and the guide polynucleotide are introduced into the immune cell via electroporation, nucleofection, cationic lipid-mediated methods, viral transduction, or a combination thereof.

12 . The method of claim 1 , further comprising depleting TCRα/β+ cells from the population of CD7 CAR-expressing immune cells.

Assignments (5)

Continuity (2)

References Cited (400)