IP Library Granted Patent US 7,214,485
Granted Patent B2
US 7,214,485 · App. 10/344,815 · Granted May 8, 2007

Nested methylation-specific polymerase chain reaction cancer detection method

Assignee: Lovelace Respiratory Research Institute
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 7,214,485
App. No.
10/344,815
Granted
May 8, 2007
Kind
B2
Abstract

A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or “nested” polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

Claims (46)

1. A method of monitoring for cancer in cells, comprising detecting the presence of gene-specific promoter methylation of DNA from cells, comprising the steps of:

a) subjecting the DNA to bisulfite modification;

b) expanding the number of copies of at least one specific gene by using a polymerase chain reaction with a first primer set to amplify a portion of the gene where the promoter methylation resides, thereby generating an amplification product; and

c) using an aliquot of the amplification product generated by the first polymerase chain reaction in a second, methylation-specific, polymerase chain reaction with a second primer set at a temperature of annealing that exceeds the melting temperature of the second primer set to amplify a portion of the gene's CpG island where the promoter methylation resides, and to detect the presence of inactivation of at least one specific gene.

2. The method of claim 1 wherein the step of expanding the number of copies of at least one specific gene comprises expanding the number of copies of more than one specific gene.

3. The method of claim 2 wherein the step of expanding the number of copies of more than one gene comprises expanding the number of copies of at least two genes in a single reaction selected from the group consisting of p16, MGMT, RASSF1A gene, H-Cadherin, retinoic acid receptor beta gene, and fragile histidine triad gene.

4. The method of claim 1 wherein the step of expanding the number of copies of a specific gene comprises amplifying a single gene.

5. The method of claim 4 wherein the step of expanding the number of copies of a single gene comprises amplifying the p16 gene.

6. The method of claim 5 wherein the step of amplifying the p16 gene comprises amplifying a 280 base pair fragment with a primer set comprising:

Forward 5′ GAGGGTGGGGCGGATCGC 3′

Reverse 5′ GACCCCGAACCGCGACCG 3′.

7. The method of claim 4 wherein the step of expanding the number of copies of a single gene comprises amplifying the MGMT gene.

8. The method of claim 7 wherein the step of amplifying the MGMT gene comprises amplifying a 289 base pair fragment with a primer set comprising:

Forward 5′ ACGTTTTGCGTTTCGACGTTC 3′

Reverse 5′ ACCCCCCACCCGACGACG 3′.

9. The method of claim 4 wherein the step of expanding the number of copies of a single gene comprises amplifying the DAP-kinase gene.

10. The method of claim 9 wherein the step of amplifying the DAP-kinase gene comprises amplifying the a 209 base pair fragment with a primer set comprising:

Forward 5′ ATAGTCGGATCGAGTTAACGTC 3′

Reverse 5′ AAAACTAACCGAAACGACGACG 3′.

11. The method of claim 4 wherein the step of expanding the number of copies of a single gene comprises amplifying the RASSF1A gene.

12. The method of claim 11 wherein the step of amplifying the RASSF1A gene comprises amplifying a 260 base pair fragment with a primer set comprising:

Forward 5′ GGGGGTTTTGCGAGAGCGC 3′

Reverse 5′ CCCGATTAAACCCGTACTTCG 3′.

13. The method of claim 1 in which said cells are human cells, and said at least one specific gene is the gene that is altered by the cancer.

14. The method of claim 13 wherein the human cells are from an obtained biological sample.

15. The method of claim 13 wherein the biological sample is selected from tissue plasma, ejaculate, cerebrospinal fluid, serum, mammary duct fluid, urine, and fecal stool and sputum.

16. The method of claim 14 wherein the step of expanding the number of copies of the gene comprises amplifying the p16 gene.

17. The method of claim 16 wherein the step of amplifying the p16 gene comprises amplifying a 280 base pair fragment with a primer set as indicated in claim 6 .

18. The method of claim 14 wherein the step of expanding the number of copies of the gene comprises amplifying the MGMT gene.

19. The method of claim 18 wherein the step of expanding the number of copies of a specific gene comprises amplifying a 289 base pair fragment with a primer set as indicated in claim 8 .

20. The method of claim 14 wherein the step of expanding the number of copies of a specific gene comprises amplifying the DAP-kinase gene.

21. The method of claim 20 wherein the step of expanding the number of copies of a specific gene comprises amplifying a 209 base pair fragment with a primer set as indicated in claim 10 .

22. The method of claim 14 wherein the step of expanding the number of copies of a specific gene comprises amplifying the RASSF1A gene.

23. The method of claim 22 wherein the step of expanding the number of copies of a specific gene comprises amplifying a 260 base pair fragment with a primer set as indicated in claim 12 .

24. A method according to claim 15 in which said method further comprises the step of contacting said DNA within said biological sample with a first primer set to expand the number of copies of a portion of the gene where the promoter CpG islands reside by using a polymerase chain reaction to generate an amplification product.

25. The method of claim 24 wherein the step of expanding the number of copies of the gene comprises amplifying the p16 gene.

26. The method of claim 25 wherein the step of amplifying the p16 gene comprises amplifying a 280 base pair fragment with a primer set as indicated in claim 6 .

27. The method of claim 24 wherein the step of expanding the number of copies of the gene comprises amplifying the MGMT gene.

28. The method of claim 27 wherein the step of expanding the number of copies of a specific gene comprises amplifying a 289 base pair fragment with a primer set as indicated in claim 8 .

29. The method of claim 24 wherein the step of expanding the number of copies of the gene comprises amplifying the H-Cadherin gene.

30. The method of claim 24 wherein the step of expanding the number of copies of the gene comprises amplifying the retinoic acid receptor beta gene.

31. The method of claim 24 wherein the step of expanding the number of copies of the gene comprises amplifying the fragile histidine triad gene.

32. The method according to claim 13 or 15 , for detecting and monitoring a particular cancer in which said DNA is present either in the cell or free in the biological sample, and in which step b) comprises amplifying the portion of the gene's CpG island where the promoter methylation CpG islands resides by using a polymerase chain reaction thereby generating an amplification product containing fragments of a gene selected from the group consisting of the p16 gene, the MGMT gene, the DAP-kinase gene and the RASSF1A gene, to detect the presence of inactivation of the gene that is altered by the particular cancer.

33. The method of claim 32 further comprising the step of obtaining a sample of the biological fluid containing the gene that is altered by the cancer.

34. The method of claim 33 wherein the biological fluid sample obtained comprises sputum.

35. The method of claim 1 wherein the temperature of annealing is 4–6° C. above the melting temperature of the second primer.

Assignments (2)
CHANGE OF NAME Recorded May 7, 2020
From: LOVELACE RESPIRATORY RESEARCH INSTITUTE
To: LOVELACE BIOMEDICAL RESEARCH INSTITUTE
Reel/Frame 052598/0940 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded May 4, 2005
From: BELINSKY, STEVEN A.; PALMISANO, WILLIAM A.
To: LOVELACE RESPIRATORY RESEARCH INSTITUTE
Reel/Frame 016190/0399 →
Continuity (2)
Provisional Application 6022805700 · Aug 25, 2000
Related Publication 20040038245A1 · Feb 26, 2004