IP Library › Granted Patent US 7,271,156
Granted Patent B2
US 7,271,156 · App. 10/314,578 · Granted Sep 18, 2007

Immunostimulatory nucleic acids

Assignees: University of Iowa Research Foundation; Coley Pharmaceutical GmbH
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 7,271,156
App. No.
10/314,578
Granted
Sep 18, 2007
Kind
B2
Abstract

The invention relates to immunostimulatory nucleic acid compositions and methods of using the compositions. The T-rich nucleic acids contain poly T sequences and/or have greater than 25% T nucleotide residues. The TG nucleic acids have TG dinucleotides. The C-rich nucleic acids have at least one poly-C region and/ore greater than 50% c nucleotides. These immunostimulatory nucleic acids function in a similar manner to nucleic acids containing CpG motifs. The invention also encompasses preferred CpG nucleic acids.

Claims (40)

1. A composition comprising

an immunostimulatory nucleic acid comprising

5′ TCGTCGTTTTGACGTTTTGTCGTT 3′ (SEQ ID NO:343).

2. The composition of claim 1 , wherein the immunostimulatory nucleic acid consists of SEQ ID NO:343.

3. The composition of claim 1 , wherein the immunostimulatory nucleic acid is equal to or less than 100 nucleotides in length.

4. The composition of claim 1 , further comprising a pharmaceutically acceptable carrier.

5. The composition of claim 1 , wherein the immunostimulatory nucleic acid is a T-rich immunostimulatory nucleic acid.

6. The composition of claim 1 , wherein the immunostimulatory nucleic acid comprises at least three poly T motifs.

7. The composition of claim 6 , wherein at least one poly T nucleic acid motif comprises

5′ X 1 X 2 TTTTX 3 X 4 3′

wherein X 1 , X 2 , X 3 and X 4 are nucleotides, and X 1 X 2 is selected from the group consisting of TT, TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, GT, GG, GA, and GC, and X 3 X 4 is selected from the group consisting of TT, TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, GT, GG, GA, and GC.

8. The composition of claim 6 , wherein the immunostimulatory nucleic acid comprises at least 4, at least 5, at least 6, at least 7, or at least 8 poly T motifs.

9. The composition of claim 6 , wherein at least two of the at least three poly T motifs each comprises a motif selected from the group consisting of at least five contiguous T nucleotide residues and at least six contiguous T nucleotide residues.

10. The composition of claim 6 , wherein at least three poly T motifs each comprises at least five contiguous T nucleotide residues.

11. The composition of claim 6 , wherein the at least three poly T motifs is at least four motifs.

12. The composition of claim 1 , wherein the immunostimulatory nucleic acid comprises a nucleotide composition selected from the group consisting of greater than 25% T, greater than 35% T, greater than 40% T, greater than 50% T, greater than 60% T, greater than 80% T, greater than 25% C, and greater than 25% A.

13. The composition of claim 1 , wherein the immunostimulatory nucleic acid comprises a length selected from the group consisting of at least 27 nucleotides and at least 30 nucleotides.

14. The composition of claim 1 , wherein the immunostimulatory nucleic acid has a niicleotide backbone that includes at least one backbone modification.

15. The composition of claim 14 , wherein the backbone modification is a phosphorothioate modification.

16. The composition of claim 14 , wherein the nucleotide backbone is chimeric.

17. The composition of claim 14 , wherein the nucleotide backbone is entirely modified.

18. The composition of claim 1 , wherein the immunostimulatory nucleic acid is formulated for delivery by a route selected from the group consisting of oral, nasal, rectal, vaginal, and ocular.

19. The composition of claim 1 , wherein the immunostimulatory nucleic acid is provided in a sustained release device.

20. The composition of claim 19 , wherein the sustained release device is a microparticle.

21. The composition of claim 1 , wherein the immunostimulatory nucleic acid is formulated in a delivery device selected from the group consisting of a capsule, a pill, and a sublingual tablet.

22. The composition of claim 1 , wherein the immunostimulatory nucleic acid is formulated for delivery locally or systemically.

23. The composition of claim 1 , wherein the immunostimulatory nucleic acid is formulated for delivery mucosally.

24. The composition of claim 1 , wherein the immunostimulatory nucleic acid is provided in an amount effective to induce an immune response in a non-rodent subject.

25. The composition of claim 24 , wherein the non-rodent subject is selected from the group consisting of a human, a dog, a cat, a horse, a cow, a pig, a sheep, a goat, a chicken, a monkey, and a fish.

26. The composition of claim 24 , wherein the immune response is selected from the group consisting of a local immune response, a systemic immune response, a mucosal immune response, an antigen specific immune response, and an innate immune response.

27. The composition of claim 1 , wherein the immunostimulatory nucleic acid is provided in an amount effective to treat asthma in a subject in need thereof.

28. The composition of claim 27 , further comprising an asthma medicament.

29. The composition of claim 1 , wherein the immunostimulatory nucleic acid is provided in an amount effective to treat allergy in a subject in need thereof.

30. The composition of claim 29 , further comprising an allergy medicament.

31. The composition of claim 1 , wherein the immunostimulatory nucleic acid comprises

5′ N 1 X 1 X 2 TGX 3 X 4 N 2 3′

wherein X 1 X 2 are nucleotides selected from the group consisting of GT, GG, GA, AA, AT, AG, CT, CA, CG, TA and TT, and X 3 X 4 are nucleotides selected from the group consisting of TT, TC, TG, TA, CT, CG, CC, CA, AC, AT, AG and AA, and N 1 and N 2 are nucleic acid sequences composed of any number of nucleotides provided that the sum total of N 1 and N 2 is in the range of 9 to 19.

32. A method of stimulating an immune response, comprising

administering the composition of claim 1 , to a non-rodent subject in an amount effective to induce an immune response in the non-rodent subject, wherein the non-rodent subject has asthma or allergy.

33. The composition of claim 22 , wherein the nucleotide backbone is entirely phosphorothioate.

Assignments (2)
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Jul 13, 2007
From: KRIEG, ARTHUR M.
To: UNIVERSITY OF IOWA RESEARCH FOUNDATION
Reel/Frame 019556/0206 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Dec 9, 2002
From: SCHETTER, CHRISTIAN; VOLLMER, JORG
To: COLEY PHARMACEUTICAL GMBH
Reel/Frame 013579/0818 →
Continuity (5)
Continuation 0966918700 · Sep 25, 2000
Provisional Application 6022743600 · Aug 23, 2000
Provisional Application 6015613500 · Sep 27, 1999
Provisional Application 6015611300 · Sep 25, 1999
Related Publication 20030212026A1 · Nov 13, 2003