Method for early diagnosis of carcinomas of the anogenital tract
A method for the early diagnosis of carcinomas of the anogenital tract, preferably of the cervical carcinoma, and the preliminary stages thereof is described. The method is based on the determination of the methylation status of segments of the gene regions of ASTN1 (astrotactin 1) and ZNF671 (zinc finger protein 671, transcription factor). A DNA methylation in the promoter region or the 5′-region of these genes is indicative for carcinomas of the anogenital tract or severe preliminary stages thereof. The present invention also relates to kits which permit the conduction of the diagnostic method according to the invention.
1. A method for detecting anogenital cancer or preliminary stages thereof in a sample, comprising determining the methylation status of ASTN1 (astrotactin 1) and ZNF671 (zinc finger protein, transcription factor), wherein ASTN1 and/or ZNF671 are methylated in a positive sample, and wherein primer pairs are used which comprise the following sequences:
(a)
CGTAAGCGTTGTTAGCGTAGC (ASTN1_F)
(SEQ ID No.: 1)
and
CGCGAAATCGAAACGAAAACG (ASTN1_R);
(SEQ ID No.: 2)
(b)
CGGAGGACGTAGTATTTATTCGC (ZNF671_F)
(SEQ ID No.: 11)
and
CTACGTCCCCGATCGAAACG (ZNF671_R).
(SEQ ID No.: 12)
2. The method according to claim 1 , wherein at least one probe is used which comprises one of the following sequences:
(a)
GTAATTCGTTTGTTTCGTAAGTTGTTCG (ASTN1);
(SEQ ID No.: 13)
(b)
CGTGGGCGCGGACAGTTGTCGGGAGCG (ZNF671).
(SEQ ID No.: 18)
3. The method according to claim 1 , additionally comprising the detection of HPV.
4. The method according to claim 3 , wherein the detection of HPV is via PCR.
5. The method according to claim 4 , wherein the HPV is detected using a primer pair comprising the following sequences:
(a)
GGTTATAATAATGGTATTTGTTGGG (HPV_F);
(SEQ ID No.: 19)
and
(b)
TAAAAAATAAACTATAAATCATATTCC (HPV_R).
(SEQ ID No.: 20)
6. A kit for detecting anogenital cancer or preliminary stages thereof in a sample, comprising: gene specific primer pairs that determine methylation and/or hypermethylation of ASTN1 (astrotactin 1) and ZNF671 (zinc finger protein, transcription factor).
7. The kit according to claim 6 , wherein primer pairs are used which comprise the following sequences:
(a)
CGTAAGCGTTGTTAGCGTAGC
(SEQ. ID No.: 1)
(ASTN1_F)
and
CGCGAAATCGAAACGAAAACG
(SEQ. ID No.: 2)
(ASTN1_R);
(b)
CGGAGGACGTAGTATTTATTCGC
(SEQ. ID No.: 11)
(ZNF671_F)
and
CTACGTCCCCGATCGAAACG
(SEQ. ID No.: 12)
(ZNF671_R).
8. The kit according to claim 6 , wherein at least one probe is used which comprises one of the following sequences:
(a)
GTAATTCGTTTGTTTCGTAAGTTGTTCG
(SEQ. ID No.: 13)
(ASTN1);
(b)
CGTGGGCGCGGACAGTTGTCGGGAGCG
(SEQ. ID No.: 18)
(ZNF671).
9. The kit according to claim 6 , additionally containing a primer pair for the detection of HPV.
10. The kit according to claim 9 , wherein the HPV is detected using a primer pair comprising the following sequences:
(a)
GGTTATAATAATGGTATTTGTTGGG
(SEQ. ID No.: 19)
(HPV_F);
and
(b)
TAAAAAATAAACTATAAATCATATTCC
(SEQ. ID No.: 20)
(HPV_R).
11. The kit according to claim 6 , containing in separate containers additionally at least one of the following constituents:
(a) reagents for isolating DNA;
(b) enzyme for DNA amplification;
(c) sodium bisulfate;
(d) one or more buffers.
12. The method of claim 1 wherein the anogenital cancer is cancer of the cervix uteri.
13. The method of claim 1 wherein the sample is a cervical smear.
14. The method of claim 1 where the methylation status of the ASTN1 and ZNF671 are determined at the promoter regions.
15. The method of claim 1 wherein the methylation status of the genes is determined by means of methylation-specific PCR (MSP).
16. The method of claim 15 wherein the MSP is a quantitative MSP (QMSP).
17. The method of claim 16 wherein the quantitative MSP is based on the MethyLight technique.
18. The method according to claim 1 wherein the method is a multiplex method.
19. The kit according to claim 7 wherein at least one probe is used which comprises one of the following sequences:
(a)
GTAATTCGTTTGTTTCGTAAGTTGTTCG
(SEQ. ID No.: 13)
(ASTN1);
(b)
CGTGGGCGCGGACAGTTGTCGGGAGCG
(SEQ. ID No.: 18)
(ZNF671).
20. The kit according to claim 19 , additionally containing a primer pair for the detection of HPV and wherein the HPV is detected using a primer pair comprising the following sequences:
(c)
GGTTATAATAATGGTATTTGTTGGG
(SEQ. ID No.: 19)
(HPV_F);
and
(d)
TAAAAAATAAACTATAAATCATATTCC
(SEQ. ID No.: 20)
(HPV_R).