IP Library › Granted Patent US 8,604,185
Granted Patent B2
US 8,604,185 · App. 12/820,122 · Granted Dec 10, 2013

Inhibitors of angiopoietin-like 4 protein, combinations, and their use

Inventors: Hanspeter Gerber (San Francisco, CA); Napoleone Ferrara (San Francisco, CA); Xiao Huan Liang (Redwood City, CA)
Assignee: Genentech, Inc.
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 8,604,185
App. No.
12/820,122
Granted
Dec 10, 2013
Kind
B2
Abstract

Modulators of angiopoietin-like 4 protein are provided along with methods for their use in the treatment of diseases and pathological conditions. Combinations of ANGPTL4 antagonists and other therapeutics, e.g., anti-cancer agents, and methods of their use in the treatment of mammals susceptible to or diagnosed with cancer, or with relapse tumor growth or relapse cancer cell growth are also provided.

Claims (4)

1. A composition comprising an ANGPTL4-SiRNA molecule, wherein the ANGPTL4-SiRNA molecule targets GTGGCCAAGCCTGCCCGAAGA (SEQ ID NO:3) within a DNA sequence encoding ANGPTL4.

2. A pharmaceutical composition comprising an anti-angiogenesis agent and a pharmaceutically acceptable carrier, where the anti-angiogenesis agent is the ANGPTL-SiRNA molecule of claim 1 .

3. The pharmaceutical composition of claim 2 , wherein the carrier is a viral vector.

4. The pharmaceutical composition of claim 2 , wherein the carrier is a liposome.

Continuity (3)
Division 11185215 · Jul 19, 2005
Provisional Application 60589782 · Jul 20, 2004
Related Publication 20110311524A1 · Dec 22, 2011