Inhibitors of angiopoietin-like 4 protein, combinations, and their use
Modulators of angiopoietin-like 4 protein are provided along with methods for their use in the treatment of diseases and pathological conditions. Combinations of ANGPTL4 antagonists and other therapeutics, e.g., anti-cancer agents, and methods of their use in the treatment of mammals susceptible to or diagnosed with cancer, or with relapse tumor growth or relapse cancer cell growth are also provided.
1. A composition comprising an ANGPTL4-SiRNA molecule, wherein the ANGPTL4-SiRNA molecule targets GTGGCCAAGCCTGCCCGAAGA (SEQ ID NO:3) within a DNA sequence encoding ANGPTL4.
2. A pharmaceutical composition comprising an anti-angiogenesis agent and a pharmaceutically acceptable carrier, where the anti-angiogenesis agent is the ANGPTL-SiRNA molecule of claim 1 .
3. The pharmaceutical composition of claim 2 , wherein the carrier is a viral vector.
4. The pharmaceutical composition of claim 2 , wherein the carrier is a liposome.