Radioprotectants targeting thrombospondin-1 and CD47
Described herein is the discovery that cell and tissue survival can be dramatically increased following radiation exposure through inhibition of the interaction between TSP-1 and CD47. This effect is shown using antisense molecules, peptides, and antibodies, which can now be used as radioprotectant agents. These agents find application in minimizing, reducing and/or preventing tissue damage following intentional and accidental radiation exposure, as well as increasing the therapeutic efficacy of radiation therapies by protecting non-target tissue from incidental radiation damage and by increasing tumor ablation following radiation treatment.
1. A method of protecting animal tissue from damage caused by ionizing radiation exposure, comprising contacting the tissue with a therapeutically effective amount of an agent that inhibits interaction between thrombospondin-1 (TSP1) and CD47, thereby protecting the tissue from radiation damage, wherein the agent is administered at a time within four days prior to the radiation exposure to within one day following the radiation exposure.
2. The method of claim 1 , which is employed as a method of protecting a subject exposed to a radioactive substance or ionizing radiation, comprising contacting tissue of the subject with the therapeutically effective amount of the agent that inhibits the interaction of TSP1 and CD47.
3. The method of claim 1 , wherein the radiation comprises an acute or chronic dose of ionizing radiation.
4. The method of claim 3 , wherein the ionizing radiation results from nuclear fission or fusion.
5. The method of claim 3 , wherein the ionizing radiation comprises X-rays.
6. The method of claim 3 , wherein the ionizing radiation comprises radionuclides.
7. The method of claim 1 , which is employed as a method of enhancing the therapeutic window for radiotherapy in a subject, comprising contacting tissue of the subject with the therapeutically effective amount of the agent that inhibits interaction between TSP1 and CD47 prior to the radiotherapy.
8. The method of claim 1 , wherein the radiation exposure comprises diagnostic X-rays, radiation therapy, a CAT-scan, a mammogram, a radionuclide scan, or an interventional radiological procedure under CT or fluoroscopy guidance.
9. The method of claim 1 , wherein the radiation exposure comprises tissue-incorporated radionuclides from inhalation, ingestion of contaminated food or water, non-medical or unintentional exposure to ionizing radiation from a nuclear weapon, non-medical or unintentional exposure to a radioactive spill, cosmic radiation, and/or space flight-associated radiation exposure.
10. The method of claim 1 , wherein inhibiting interaction between TSP1 and CD47 comprises one or more of the following:
inhibiting expression of CD47;
inhibiting expression of TSP1; or blockading the interaction between endogenous TSP1 and CD47.
11. The method of claim 1 , wherein the agent that inhibits the interaction between TSP1 and CD47 comprises:
an isolated or recombinant CD47 molecule or soluble fragment thereof;
an agent that decreases the expression of CD47;
an agent that decreases the expression of TSP1;
an anti-CD47 antibody;
an antibody that specifically binds TSP1;
TSP1 peptide 7N3 (SEQ ID NO:2);
TSP1 peptide C6d (SEQ ID NO:1); or
a mixture or combination of two or more thereof.
12. The method of claim 1 , wherein the agent that inhibits the interaction of TSP1 and CD47 is selected from the group consisting of peptide 7N3 (SEQ ID NO: 2) and peptide C6d (SEQ ID NO: 1).
13. The method of claim 11 , wherein the agent that decreases the expression of CD47 or TSP1 is:
an oligonucleotide comprising at least 15 bases that hybridizes to the mRNA of CD47;
an oligonucleotide comprising at least 15 bases that hybridizes to the mRNA of TSP1;
an oligonucleotide comprising about 15 bases that hybridizes to the mRNA of CD47; or
an oligonucleotide comprising about 15 bases that hybridizes to the mRNA of TSP1.
14. The method of claim 1 , wherein the agent is:
an oligonucleotide comprising at least 15 bases and wherein the oligonucleotide hybridizes to the mRNA of CD47 or
an oligonucleotide comprising about 15 bases and wherein the oligonucleotide hybridizes to the mRNA of CD47.
15. The method of claim 14 , wherein the oligonucleotide is a morpholino.
16. The method of claim 15 , wherein the morpholino comprises the sequence shown in SEQ ID NO: 4 (CGTCACAGGCAGGACCCACTGCCCA).
17. The method of claim 1 , wherein the agent is an anti-CD47 antibody or a fragment thereof, or an antibody that specifically binds to TSP1 or a fragment thereof.
18. The method of claim 17 , wherein the antibody is a humanized antibody.
19. The method of claim 1 , wherein the agent is monoclonal antibody A6.1, monoclonal antibody C6.7, monoclonal antibody MIAP301, monoclonal antibody OX101, monoclonal antibody B6H12, an antibody that competes with A6.1, C6.7, MIAP301, OX101, or B6H12 for binding, a binding fragment of any one of these, or a humanized version of any one of these.
20. A method of increasing tumor ablation in a subject undergoing radiotherapy comprising contacting tissue of the subject with a therapeutically effective amount of an agent that inhibits interaction between TSP1 and CD47 prior to the radiotherapy, wherein the agent comprises:
an isolated or recombinant CD47 molecule or soluble fragment thereof;
an agent that decreases the expression of CD47;
an agent that decreases the expression of TSP1;
an anti-CD47 antibody;
an antibody that specifically binds TSP1;
TSP1 peptide 7N3 (SEQ ID NO:2);
TSP1 peptide C6d (SEQ ID NO:1); or
a mixture or combination of two or more thereof, thereby increasing tumor ablation.
21. The method of claim 20 , wherein the agent that decreases the expression of CD47 or TSP1 is:
an oligonucleotide comprising at least 15 bases that hybridizes to the mRNA of CD47;
an oligonucleotide comprising at least 15 bases that hybridizes to the mRNA of TSP1;
an oligonucleotide comprising about 15 bases that hybridizes to the mRNA of CD47; or
an oligonucleotide comprising about 15 bases that hybridizes to the mRNA of TSP1.