Oligonucleotide probe set and methods of microbiota profiling
Described herein is a set of oligonucleotide probes. Also included are methods of using the oligonucleotide probes in profiling the microbiota of the GI tract of a subject and methods of diagnosing or monitoring a disease or condition in a subject or predicting or assessing the risk of a subject developing a disease or condition. Kits comprising the oligonucleotide probe set described herein are also provided.
1. A set of oligonucleotide probes, said set comprising:
(a) an oligonucleotide probe consisting of a nucleotide sequence ACGCTTGCACCCT (SEQ ID NO 1), optionally with up to three substituted bases, optionally with 1 to 10 additional nucleotides added to the 5′ and/or 3′ end, or AGGGTGCAAGCGT (SEQ ID NO 27), optionally with up to three substituted bases, optionally with 1 to 10 additional nucleotides added to the 5′ and/or 3′ end;
(b) an oligonucleotide probe consisting of a nucleotide sequence CGATCCGAAAACCTTCTTCACT (SEQ ID NO 2), optionally with up to three substituted bases, optionally with 1 to 10 additional nucleotides added to the 5′ or 3′ end, or AGTGAAGAAGGTTTTCGGATCG (SEQ ID NO 28), optionally with up to three substituted bases, optionally with 1 to 10 additional nucleotides added to the 5′ or 3′ end;
(c) an oligonucleotide probe consisting of a nucleotide sequence GGACAACGCTTGCCAC (SEQ ID NO 3), optionally with up to three substituted bases, optionally with 1 to 10 additional nucleotides added to the 5′ or 3′ end, or GTGGCAAGCGTTGTCC (SEQ ID NO 29), optionally with up to three substituted bases, optionally with 1 to 10 additional nucleotides added to the 5′ or 3′ end;
(d) an oligonucleotide probe consisting of a nucleotide sequence CGTAGGCGGTTCGTCGCGT (SEQ ID NO 4), optionally with up to three substituted bases, optionally with 1 to 10 additional nucleotides added to the 5′ or 3′ end, or ACGCGACGAACCGCCTACG (SEQ ID NO 30), optionally with up to three substituted bases, optionally with 1 to 10 additional nucleotides added to the 5′ or 3′ end; and
(e) one or more oligonucleotide probes consisting of a nucleotide sequence selected from those recited in Table 1, optionally with up to three substituted bases, optionally with 1 to 10 additional nucleotides added to the 5′ or 3′ end; and optionally
(f) one or more oligonucleotide probes consisting of a nucleotide sequence selected from those recited in Table 2 and Table 3, optionally with up to three substituted bases, optionally with 1 to 10 additional nucleotides added to the 5′ or 3′ end, wherein each of oligonucleotide probes (a) to (e), or if present (f), is labelled with a moiety for detection or manipulation or is immobilized onto one or more solid supports.
2. The oligonucleotide probe set of claim 1 , wherein component (f) is present in the probe set and is one or more oligonucleotides consisting of a nucleotide sequence selected from those recited in Table 2.
3. The oligonucleotide probe set of claim 1 , wherein said moiety is colorimetric, chemiluminescent, chromogenic, radioactive, fluorescent, an enzyme, an antibody fragment, a His-tag, biotin or streptavidin.
4. The oligonucleotide probe set of claim 1 , wherein the one or more solid supports is selected from particles, sheets, gels, filters, membranes, fibres, capillaries, chips, microtitre strips, slides, tubes, plates and wells.
5. The oligonucleotide probe set of claim 4 , wherein said solid support, is a magnetic particle.
6. The oligonucleotide probe set of claim 4 , wherein said solid support is labelled with a dye or a plurality of dyes.