Preparation of microvesicle-siRNA complexes and use thereof in AIDS treatment
The present invention provides drugs for treating AIDS, which comprises microvesicles carrying anti-HIV specific siRNA. The present invention also provides a preparation method of the drug.
1. A cellular microvesicles-anti-HIV specific siRNA complex, comprising at least one cellular microvesicle and at least one small interfering RNA (siRNA) sequence carried by the microvesicle, wherein the siRNA sequence is an anti-HIV specific siRNA sequence that includes the nucleic acid sequence GCCCUUCAGACAGGAUCAGAA (SEQ ID NO: 1).
2. The complex according to claim 1 , wherein the cellular microvesicles are obtained from donor cells of human or animals.
3. The complex according to claim 2 , wherein the donor cell includes at least one of a cell line and a primary cell culture.
4. The complex according to claim 2 , wherein the cellular microvesicles are biologic vesicles structures.
5. The complex according to claim 1 , wherein anti-HIV specific siRNA is encapsulated in cellular microvesicles.
6. The complex according to claim 1 , wherein the mean diameter of the cellular microvesicles is 10-500 nm.
7. The complex according to claim 1 , wherein the cellular microvesicles include at least one of an exosome and a shedding vesicle.
8. The complex according to claim 1 , wherein the anti-HIV specific siRNA includes a siRNA sequence targeting HIV genome, and the anti-HIV specific siRNA causes specific degradation of HIV genome.
9. A pharmaceutical composition comprising the cellular microvesicles-anti-HIV specific siRNA complex according to claim 1 including the sequence GCCCUUCAGACAGGAUCAGAA (SEQ ID NO: 1).
10. A method for treating AIDS, including: transferring the cellular microvesicles-anti-HIV specific siRNA complex according to claim 1 having into a cell, wherein the complex comprises at least one cellular microvesicle and at least one small interfering RNA (siRNA) sequence carried by the microvesicle, wherein the siRNA sequence is an anti-HIV specific siRNA sequence that includes the nucleic acid sequence GCCCUUCAGACAGGAUCAGAA (SEQ ID NO: 1).
11. The method according to claim 10 , wherein the cell is in an AIDS patient or HIV carrier.
12. The method according to claim 10 , wherein the cell is one of a cell line infected with HIV, and a primary culture of tissues/cells of an AIDS patient or HIV carrier.
13. A method of using cellular microvesicles-anti-HIV specific siRNA complexes in the preparation of a drug for treating AIDS or HIV infection, comprising the steps of:
(1) designing an siRNA sequence that includes the nucleic acid sequence GCCCUUCAGACAGGAUCAGAA (SEQ ID NO:1) that targets an HIV virus genome;
(2) artificially synthesizing the siRNA sequence or a DNA sequence encoding for expression of said siRNA sequence;
(3) transferring the synthesized siRNA or expression sequence into host cells;
(4) collecting a culture medium of the cells into which the siRNA has been transferred; and
(5) isolating cellular microvesicles-anti-HIV specific siRNA complexes from the culture medium for use in a pharmaceutical composition.
14. The method of claim 13 , wherein the step of transferring the siRNA into host cells further comprises transfecting said artificially synthesized mature siRNA into cells.
15. The method of claim 13 , wherein the step of transferring the siRNA into host cells further comprises transfecting a viral vector or plasmid carrying said siRNA expression sequence into cells.
16. The method of claim 13 , wherein the step of transferring the siRNA into host cells further comprises using a liposome or electroporation to transfecting the mature siRNA or expression sequence into the cells.
17. The method of claim 13 , wherein the step of transferring the siRNA into host cells further comprises establishing one or more cell lines permanently expressing said siRNA.
18. The method according to claim 13 , wherein the step of isolating the cellular microvesicles-anti-HIV specific siRNA complexes further comprises separating and purifying the complexes by performing at least one of a differential centrifugation, an immuno-adsorption and an ultrafiltration.
19. A method for preparing the cellular microvesicles-anti-HIV specific siRNA complexes according to claim 1 , comprising the following steps:
(1) designing an siRNA sequence that includes the nucleic acid sequence GCCCUUCAGACAGGAUCAGAA (SEQ ID NO:1) that targets an HIV virus genome;
(2) artificially synthesizing the siRNA sequence or a DNA sequence encoding for expression of said siRNA sequence;
(3) transferring the synthesized siRNA or expression sequence into host cells;
(4) collecting a culture medium of the cells into which the siRNA has been transferred; and
(5) isolating cellular microvesicles-anti-HIV specific siRNA complexes from the culture medium for use in a pharmaceutical composition.
20. The method of claim 19 , wherein the step of transferring the siRNA into host cells further comprises transfecting said artificially synthesized mature siRNA into cells.
21. The method of claim 19 , wherein the step of transferring the siRNA into host cells further comprises transfecting a viral vector or plasmid carrying said siRNA expression sequence into cells.
22. The method of claim 19 , wherein the step of transferring the siRNA into host cells further comprises using a liposome or electroporation to transfecting the mature siRNA or expression sequence into the cells.
23. The method of claim 19 , wherein the step of transferring the siRNA into host cells further comprises establishing one or more cell lines permanently expressing said siRNA.
24. The method according to claim 19 , wherein the step of isolating the cellular microvesicles-anti-HIV specific siRNA complexes further comprises separating and purifying the complexes by performing at least one of a differential centrifugation, an immuno-adsorption and an ultrafiltration.