IP Library Granted Patent US 9,421,167
Granted Patent B2
US 9,421,167 · App. 13/700,062 · Granted Aug 23, 2016

Preparation of microvesicle-siRNA complexes and use thereof in AIDS treatment

Inventors: Chenyu Zhang (Beijing, CN); Ke Zeng (Beijing, CN); Hongwei Gu (Beijing, CN); Minghui Cao (Beijing, CN); Liming Li (Beijing, CN)
Assignee: Micromedmark Biotech Co. Ltd.
A61K9/127C12N15/111C12N15/1131A61K9/5184C12N2310/14C12N2320/32Y10T428/2982
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 9,421,167
App. No.
13/700,062
Granted
Aug 23, 2016
Kind
B2
Abstract

The present invention provides drugs for treating AIDS, which comprises microvesicles carrying anti-HIV specific siRNA. The present invention also provides a preparation method of the drug.

Claims (34)

1. A cellular microvesicles-anti-HIV specific siRNA complex, comprising at least one cellular microvesicle and at least one small interfering RNA (siRNA) sequence carried by the microvesicle, wherein the siRNA sequence is an anti-HIV specific siRNA sequence that includes the nucleic acid sequence GCCCUUCAGACAGGAUCAGAA (SEQ ID NO: 1).

2. The complex according to claim 1 , wherein the cellular microvesicles are obtained from donor cells of human or animals.

3. The complex according to claim 2 , wherein the donor cell includes at least one of a cell line and a primary cell culture.

4. The complex according to claim 2 , wherein the cellular microvesicles are biologic vesicles structures.

5. The complex according to claim 1 , wherein anti-HIV specific siRNA is encapsulated in cellular microvesicles.

6. The complex according to claim 1 , wherein the mean diameter of the cellular microvesicles is 10-500 nm.

7. The complex according to claim 1 , wherein the cellular microvesicles include at least one of an exosome and a shedding vesicle.

8. The complex according to claim 1 , wherein the anti-HIV specific siRNA includes a siRNA sequence targeting HIV genome, and the anti-HIV specific siRNA causes specific degradation of HIV genome.

9. A pharmaceutical composition comprising the cellular microvesicles-anti-HIV specific siRNA complex according to claim 1 including the sequence GCCCUUCAGACAGGAUCAGAA (SEQ ID NO: 1).

10. A method for treating AIDS, including: transferring the cellular microvesicles-anti-HIV specific siRNA complex according to claim 1 having into a cell, wherein the complex comprises at least one cellular microvesicle and at least one small interfering RNA (siRNA) sequence carried by the microvesicle, wherein the siRNA sequence is an anti-HIV specific siRNA sequence that includes the nucleic acid sequence GCCCUUCAGACAGGAUCAGAA (SEQ ID NO: 1).

11. The method according to claim 10 , wherein the cell is in an AIDS patient or HIV carrier.

12. The method according to claim 10 , wherein the cell is one of a cell line infected with HIV, and a primary culture of tissues/cells of an AIDS patient or HIV carrier.

13. A method of using cellular microvesicles-anti-HIV specific siRNA complexes in the preparation of a drug for treating AIDS or HIV infection, comprising the steps of:

(1) designing an siRNA sequence that includes the nucleic acid sequence GCCCUUCAGACAGGAUCAGAA (SEQ ID NO:1) that targets an HIV virus genome;

(2) artificially synthesizing the siRNA sequence or a DNA sequence encoding for expression of said siRNA sequence;

(3) transferring the synthesized siRNA or expression sequence into host cells;

(4) collecting a culture medium of the cells into which the siRNA has been transferred; and

(5) isolating cellular microvesicles-anti-HIV specific siRNA complexes from the culture medium for use in a pharmaceutical composition.

14. The method of claim 13 , wherein the step of transferring the siRNA into host cells further comprises transfecting said artificially synthesized mature siRNA into cells.

15. The method of claim 13 , wherein the step of transferring the siRNA into host cells further comprises transfecting a viral vector or plasmid carrying said siRNA expression sequence into cells.

16. The method of claim 13 , wherein the step of transferring the siRNA into host cells further comprises using a liposome or electroporation to transfecting the mature siRNA or expression sequence into the cells.

17. The method of claim 13 , wherein the step of transferring the siRNA into host cells further comprises establishing one or more cell lines permanently expressing said siRNA.

18. The method according to claim 13 , wherein the step of isolating the cellular microvesicles-anti-HIV specific siRNA complexes further comprises separating and purifying the complexes by performing at least one of a differential centrifugation, an immuno-adsorption and an ultrafiltration.

19. A method for preparing the cellular microvesicles-anti-HIV specific siRNA complexes according to claim 1 , comprising the following steps:

(1) designing an siRNA sequence that includes the nucleic acid sequence GCCCUUCAGACAGGAUCAGAA (SEQ ID NO:1) that targets an HIV virus genome;

(2) artificially synthesizing the siRNA sequence or a DNA sequence encoding for expression of said siRNA sequence;

(3) transferring the synthesized siRNA or expression sequence into host cells;

(4) collecting a culture medium of the cells into which the siRNA has been transferred; and

(5) isolating cellular microvesicles-anti-HIV specific siRNA complexes from the culture medium for use in a pharmaceutical composition.

20. The method of claim 19 , wherein the step of transferring the siRNA into host cells further comprises transfecting said artificially synthesized mature siRNA into cells.

21. The method of claim 19 , wherein the step of transferring the siRNA into host cells further comprises transfecting a viral vector or plasmid carrying said siRNA expression sequence into cells.

22. The method of claim 19 , wherein the step of transferring the siRNA into host cells further comprises using a liposome or electroporation to transfecting the mature siRNA or expression sequence into the cells.

23. The method of claim 19 , wherein the step of transferring the siRNA into host cells further comprises establishing one or more cell lines permanently expressing said siRNA.

24. The method according to claim 19 , wherein the step of isolating the cellular microvesicles-anti-HIV specific siRNA complexes further comprises separating and purifying the complexes by performing at least one of a differential centrifugation, an immuno-adsorption and an ultrafiltration.

Assignments (1)
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Jan 18, 2013
From: KE, CHENYU; ZENG, KE; GU, HONGWEI; CAO, MINGHUI; LI, LIMING
To: MICROMEDMARK BIOTECH CO. LTD.
Reel/Frame 029655/0982 →
Priority Claims (2)
CN 2010 1 0187578 · May 26, 2010 · national
WO PCT/CN2010/073262 · May 26, 2010 · international
Continuity (1)
Related Publication 20130203837A1 · Aug 8, 2013