Use of miR-23a-3p and/or miR-27a-3p mimics as therapeutic agents for inhibition of neuronal apoptosis following brain injury
The present invention relates to a method for treating a brain injury due to a traumatic event, disease or ischemic attack in a mammal subject, wherein the method comprises administering to the mammal subject an effective amount of miR-23a-3p and/or miR-27a-3p mimics to reduce activation of Puma, Noxa and Bax therby causing a subsequent reduction in neuronal apoptosis.
1. A method for treating a brain injury due to a traumatic event in a mammalian subject in need of treatment thereof, the method comprising administering by intracerebroventricular injection to the mammal subject an effective amount of a miR-23a-3p and/or miR-27a-3p mimic to reduce activation of Puma, Noxa and Bax to reduce neuronal apoptosis, wherein the miR-23a-3p and/or miR-27a-3p mimic is administered within one hour to ten hours of the brain injury.
2. The method of claim 1 , wherein the miR-23a-3p and miR-27a-3p mimic is a double stranded nucleic acid molecule.
3. The method of claim 1 , wherein the miR-23a-3p and miR-27a-3p mimic comprises a nucleotide sequence of AUCACAUUGCCAGGGAUUUCC (SEQ ID NO: 1) and UUCACAGUGGCUAAGUUCCGC (SEQ ID NO: 2), respectively.
4. The method of claim 1 , wherein the traumatic event is an inertia injury due to sudden acceleration or deceleration, an impact injury or a penetrating injury.
5. The method of claim 1 , wherein the effective amount of the miR-23a-3p and/or miR-27a-3p mimic is from about 1 nanomole to about 1 micromole per kg of body weight.
6. The method of claim 5 , wherein the effective amount of the miR-23a-3p and/or miR-27a-3p mimic is from about 10 nanomoles to about 100 nanomoles per kg of body weight.
7. A method of protecting neuronal cells from cell death, the method comprising the step of supplying to the neuronal cells an effective amount of at least one miRNA mimic selected from the group consisting of miR-23a-3p mimic and miR-27a-3p mimic in an amount sufficient to reduce levels of Puma, Noxa and Bax.
8. The method of claim 7 , wherein the miR-23a-3p and miR-27a-3p mimics comprise a nucleotide sequence of AUCACAUUGCCAGGGAUUUCC (SEQ ID NO: 1) and UUCACAGUGGCUAAGUUCCGC (SEQ ID NO: 2), respectively.
9. A method for blocking a step in the apoptotic biochemical cascade to reduce neuronal tissue or cell death, the method comprising:
contacting neuronal tissue or cells with a miRNA mimic in an amount sufficient to target a pro-apoptotic gene downstream of p53 including PUMA, Noxa, and/or Bax and cause down-regulation of PUMA, Noxa, and/or Bax, wherein the miRNA mimic is selected from the group consisting of miR-23a-3p and miR-27a-3p mimics.
10. The method of claim 9 , wherein the neuronal tissues or cells are transfected with the miRNA mimic.
11. The method of claim 9 , wherein the miR-23a-3p and miR-27a-3p mimics comprise a nucleotide sequence of AUCACAUUGCCAGGGAUUUCC (SEQ ID NO: 1) and UUCACAGUGGCUAAGUUCCGC (SEQ ID NO: 2), respectively.