Methods of murine astrovirus detection
Novel murine astroviruses, and methods of detecting the viruses are disclosed. Also disclosed are uses of the viruses and infected animals as model systems for discovery and development of vaccines and therapies for diseases caused by or associated with astrovirus infection, including human astrovirus-based diseases.
1. A method of detecting the presence, absence or quantity of a murine astrovirus in a mouse sample, the method comprising:
providing a sample from a mouse comprising or suspected of comprising a murine astrovirus wherein the mouse sample is selected from the group consisting of a fecal sample, a vomitus sample, a tissue sample and a blood sample;
synthesizing cDNA using sample RNA as a template;
contacting the cDNA with at least one primer comprising a sequence having at least 95% sequence identity with
(SEQ ID NO: 6)
CCAAGAAAGAGGCACTAGTGGCACTC
(SEQ ID NO: 7)
GTTTTTTTTTTTTTTTTTTTTTGCCAATTTTTATGCCAATTATATCACCC
or
(SEQ ID NO: 9)
GTGTCACTAACGCGCACCTTTTCA;
and
performing a quantitative PCR assay comprising the cDNA and the at least one primer, thereby detecting the presence, absence or quantity of a murine astrovirus nucleic acid.
2. A method of detecting the presence, absence or quantity of a murine astrovirus in a mouse sample in accordance with claim 1 , wherein the at least one primer that has at least 95% sequence identity with SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:9, has 100% sequence identity with SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:9.
3. A method according to claim 1 , wherein the sample is a fecal sample.