Discrimination of blood type variants
The present invention provides a method for detecting the presence or absence of, or for discriminating between, blood type variants, including RHD*r′s, RHD*DIIIa and RHD*DIVa-2. The method comprises amplifying by PCR a sample obtained from a human subject at intron 3 of the RHD gene locus. The invention also provides products, in particular, probes, primers and kits for use in the method of the invention.
1. An oligonucleotide polymerase chain reaction (PCR) primer, the nucleotide sequence of which comprises the sequence:
(SEQ ID NO: 10)
AAATTTGATCATGTAGTAATCATAC;
or
(SEQ ID NO: 9)
AAATTTGATCATGTACTAATGATAC.
2. An oligonucleotide polymerase chain reaction (PCR) primer, the nucleotide sequence of which comprises the sequence:
(SEQ ID NO: 10)
AAATTTGATCATGTAGTAATCATAC;
or
(SEQ ID NO: 9)
AAATTTGATCATGTACTAATGATAC,
wherein at least one nucleotide of said primer is a biotinylated nucleotide, a fluorescently labelled nucleotide, or a locked nucleic acid (LNA) nucleotide.
3. The primer according to claim 1 , wherein said primer is suitable for use as a forward PCR primer in a PCR amplification of a portion of the r′ S allele of intron 3 of the RHD gene.
4. A plurality of oligonucleotide primers comprising:
(i) the oligonucleotide primer as defined in claim 1 ; and
(ii) at least one primer selected from the group consisting of:
(a) an oligonucleotide primer of between 26 and 30 nucleotides in length comprising the nucleotide sequence GGAAAAGGTTTGAGAGGAATTATATT (SEQ ID NO: 11) or a variant thereof differing by not more than 3 nucleotide substitutions from the nucleotide sequence of SEQ ID NO: 11, provided that said substitutions do not include substitution of the final T of the nucleotide sequence of SEQ ID NO: 11;
(b) an oligonucleotide primer comprising the nucleotide sequence GGAAAAGGTTTGAGAGGAATTATATT (SEQ ID NO: 11);
(c) the RHCE c forward primer consisting of the nucleotide sequence TGGGCTTCCTCACCTCAAA (SEQ ID NO: 12);
(d) the RHCE c reverse primer consisting of the nucleotide sequence TGATGACCACCTTCCCAGG (SEQ ID NO: 13);
(e) the RHCE C forward primer consisting of the nucleotide sequence GGCCACCACCATTTGAA (SEQ ID NO: 14);
(f) the RHCE C reverse primer consisting of the nucleotide sequence GGTAGCAGGCGTCTGTAAAAA (SEQ ID NO: 15);
(g) the RHCE exon 1 forward primer consisting of the nucleotide sequence CATAGACAGGCCAGCACAG (SEQ ID NO: 16);
(h) the RHCE exon 1 reverse primer consisting of the nucleotide sequence TGCCCCTGGAGAACCAT (SEQ ID NO: 17);
(i) the RHCE exon 5 forward primer consisting of the nucleotide sequence AAATTAAAATAAGCATTTGACCATC (SEQ ID NO: 18);
(j) the RHCE exon 5 reverse primer consisting of the nucleotide sequence CCTGAGATGGCTGTCACCAC (SEQ ID NO: 19);
(k) the RHCE exon 7 forward primer consisting of the nucleotide sequence ACATGCCATTGCCGTTC (SEQ ID NO: 20); and
(l) the RHCE exon 7 reverse primer consisting of the nucleotide sequence TCTCACCTGCCAATCTGCT (SEQ ID NO: 21).
5. The plurality of oligonucleotide primers according to claim 4 , wherein said primers comprise:
a forward primer comprising the nucleotide sequence:
(SEQ ID NO: 10)
AAATTTGATCATGTAGTAATCATAC;
or
(SEQ ID NO: 9)
AAATTTGATCATGTACTAATGATAC;
and
a reverse primer comprising the nucleotide sequence:
(SEQ ID NO: 11)
GGAAAAGGTTTGAGAGGAATTATATT.
6. A kit for assessing a subject's blood type, said kit comprising:
the plurality of primers as defined in claim 4 ;
optionally, one or more probes and/or primers that span one or more polymorphic positions in intron 3, exon 3, exon 4, intron 7 and/or exon 7 of the RHD gene locus; and
optionally, one or more probes and/or primers that span one or more polymorphic positions in exon 7 of the RHCE gene locus.
7. A system for use in determining a subject's blood type, the system comprising:
the kit as defined in claim 6 ; and
at least one detector arranged to detect a signal from detectably labelled DNA obtained from said subject or a detectably labelled amplicon produced by PCR amplification carried out on DNA obtained from said subject;
at least one controller in communication with the at least one detector, the controller being programmed with computer-readable instructions to transform said signal into predicted blood type haplotypes, and optionally, to transform said predicted blood type haplotypes into a predicted blood type phenotype.
8. A method for determining the presence or absence of, or for discriminating between, blood type alleles in a DNA-containing sample, which method comprises amplification by polymerase chain reaction (PCR) of at least a portion of intron 3 of the RHD gene, wherein said PCR employs at least a forward primer and a reverse primer each capable of hybridising to the portion of r′ S intron 3 sequence set forth in SEQ ID NO: 31, or its complement, and wherein said forward primer is as defined in claim 1 .
9. The method according to claim 8 , wherein said blood type alleles are alleles that comprise an RHD/RHCE hybrid exon 3.
10. The method according to claim 8 , wherein said blood type alleles are selected from the group consisting of: RHD*r′ S ; RHD*r′ S -like; RHD*r′ S Type 1; RHD*r′ S Type 2; RHD*DIIIa; RHD*DIIIa IVS3+3100G; RHD*DIII_FN; RHD*DIVa-2; RHD*DIVa; RHD*DIII-type4; RHD*DIII-type6; RHD*DIII-type7; RHD*DIII-type8; RHCE*ce S ; RHCE*ce S 1006T; RHCE*ce S 1006C; RHCE*ce733G; RHCE*ce48C,733G,1025T; RHCE*ce48C,697G,733G; RHCE*ce340T,733G; and RHCE*ce48C,733G,748A.
11. The method according to claim 8 , wherein said PCR amplifies r′ S , but does not amplify one or more of: RHD; RHCE*ce; RHD*DIIIa; RHD*DIIIa IVS3+3100G; and RHD*DIVa.
12. The method according to claim 11 , wherein said PCR amplifies r′ S , but does not amplify any of RHD; RHCE*ce; RHD*DIIIa; RHD*DIIIa IVS3+3100G; and RHD*DIVa.
13. The method according to claim 8 , wherein said forward primer comprises the nucleotide sequence AAATTTGATCATGTAGTAATCATAC (SEQ ID NO: 10), and said reverse primer comprises the nucleotide sequence GGAAAAGGTTTGAGAGGAATTATATT (SEQ ID NO: 11).
14. The method according to claim 8 , wherein the method further comprises genotyping the sample at one or more positions of single nucleotide polymorphism (SNP) in the RHD and/or RHCE gene loci.
15. The method according to claim 14 , wherein the method further comprises genotyping the sample at one or more of:
(i) position 410 of the RHD exon 3;
(ii) position 602 of the RHD exon 4;
(iii) position 1048 of the RHD exon 7;
(iv) position 1006 of the RHCE exon 7; and
(v) position 3100 of the RHD intron 3.
16. A method of blood matching, the method comprising:
carrying out the method according to claim 8 on a recipient sample from a recipient subject in need of donor blood and on a donor sample from a potential donor subject;
comparing the blood type alleles present in the recipient sample with those present in the donor subject and thereby determining the compatibility of the recipient subject to receive blood from the potential donor subject.
17. An oligonucleotide primer pair comprising:
(i) an oligonucleotide forward primer comprising the nucleotide sequence of AAATTTGATCATGTACTAATCATAC (SEQ ID NO: 7), AAATTTGATCATGTAGTAATCATAC (SEQ ID NO: 10), or AAATTTGATCATGTACTAATGATAC (SEQ ID NO: 9), wherein at least one nucleotide of said forward primer is a biotinylated nucleotide, a fluorescently labelled nucleotide, or a locked nucleic acid (LNA) nucleotide; and
(ii) an oligonucleotide reverse primer comprising the nucleotide sequence of GGAAAAGGTTTGAGAGGAATTATATT (SEQ ID NO: 11),
wherein the oligonucleotide primer pair is capable of specific amplification of a portion of intron 3 of the RHD gene found in r′ S .