Therapeutic nanoparticles and methods of use thereof
Provided herein are therapeutic nanoparticles having a diameter of between 10 nm to 30 nm, and containing a polymer coating, and a nucleic acid containing a sequence complementary to a sequence within a micro-RNA identified as having a role in cancer cell metastasis or anti-apoptotic activity in a cancer cell (e.g., miR-10b) or a sequence within an mRNA encoding a pro-apoptotic protein that is covalently linked to the nanoparticle. Also provided are pharmaceutical compositions containing these therapeutic nanoparticles. Also provided herein are methods of decreasing cancer cell invasion or metastasis in a subject having a cancer and methods of treating a metastatic cancer in a lymph node in a subject that require the administration of these therapeutic nanoparticles to a subject.
1. A therapeutic nanoparticle, wherein said therapeutic nanoparticle:
comprises a polymer coating, and
a nucleic acid comprising at least 10 contiguous nucleotides within the sequence of CACAAATTCGGTTCTACAGGGTA (SEQ ID NO: 18) that is covalently linked to a nanoparticle.
2. The therapeutic nanoparticle of claim 1 , wherein the nucleic acid comprises SEQ ID NO: 18.
3. The therapeutic nanoparticle of claim 1 , wherein the nucleic acid comprises at least one modified nucleotide.
4. The therapeutic nanoparticle of claim 3 , wherein the at least one modified nucleotide is a locked nucleotide.
5. The therapeutic nanoparticle of claim 1 , wherein the nanoparticle further comprises a covalently-linked fluorophore.
6. The therapeutic nanoparticle of claim 5 , wherein the fluorophore absorbs near-infrared light.
7. The therapeutic nanoparticle of claim 5 , wherein the fluorophore is covalently-linked to the nanoparticle through a chemical moiety comprising a secondary amine.
8. The therapeutic nanoparticle of claim 1 , wherein the polymer coating comprises dextran.
9. The therapeutic nanoparticle of claim 1 , wherein the nucleic acid is a small interfering RNA (siRNA) molecule.
10. The therapeutic nanoparticle of claim 1 , wherein the nucleic acid is covalently-linked to the nanoparticle through a chemical moiety comprising a disulfide bond or a thioether bond.
11. The therapeutic nanoparticle of claim 1 , wherein the nanoparticle is magnetic.
12. A pharmaceutical composition comprising the therapeutic nanoparticle of claim 1 and a pharmaceutically acceptable carrier.
13. A method for treating a metastatic cancer in a subject, the method comprising:
administering to the subject in need thereof a therapeutic nanoparticle comprising a polymer coating and a nucleic acid comprising at least 10 contiguous nucleotides within the sequence of CACAAATTCGGTTCTACAGGGTA (SEQ ID NO: 18) that is covalently or non-covalently linked to a nanoparticle,
wherein the therapeutic nanoparticle is administered in an amount sufficient to treat the metastatic cancer in the subject.
14. The method of claim 13 , wherein the therapeutic nanoparticle is administered to the subject by intravenous administration, subcutaneous, intraarterial, intramuscular, or intraperitoneal administration.
15. The method of claim 13 , wherein the metastatic cancer is localized in breast, lymph nodes, lung, bone, brain, liver, ovary, peritoneum, muscle tissue, pancreas, prostate, esophagus, colon, rectum, stomach, nasopharyngeal or skin.
16. The method of claim 13 , wherein the nucleic acid comprises SEQ ID NO: 18.
17. The method of claim 13 , wherein the nucleic acid comprises at least one modified nucleotide.
18. The method of claim 17 , wherein the at least one modified nucleotide is a locked nucleotide.
19. The method of claim 13 , wherein the therapeutic nanoparticle further comprises a covalently-linked fluorophore.
20. The method of claim 19 , wherein the fluorophore absorbs near-infrared light.
21. The method of claim 19 , wherein the fluorophore is covalently-linked to the therapeutic nanoparticle through a chemical moiety comprising a secondary amine.
22. The method of claim 13 , wherein the polymer coating comprises dextran.
23. The method of claim 13 , wherein the nucleic acid is covalently linked to the therapeutic nanoparticle through a chemical moiety comprising a disulfide bond or a thioether bond.
24. The method of claim 13 , further comprising administering one or more additional chemotherapeutic agents, wherein the one or more additional chemotherapeutic agents is administered prior, concurrently, or after administration of the therapeutic nanoparticle.
25. The method of claim 24 , wherein the one or more additional chemotherapeutic agents are selected from the group consisting of cyclophosphamide, mechlorethamine, chlorambucil, melphalan, daunorubicin, doxorubicin, epirubicin, idarubicin, mitoxantrone, valrubicin, paclitaxel, docetaxel, etoposide, teniposide, tafluposide, azacitidine, azathioprine, capecitabine, cytarabine, doxifluridine, fluorouracil, gemcitabine, mercaptopurine, methotrexate, tioguanine, bleomycin, carboplatin, cisplatin, oxaliplatin, all-trans retinoic acid, vinblastine, vincristine, vindesine, vinorelbine, and bevacizumab.
26. The method of claim 13 , further comprising administering a radiotherapy treatment.
27. The method of claim 13 , further comprising administering molecularly targeted therapy.
28. The method of claim 27 , wherein the molecularly targeted therapy is Herceptin.