IP Library Granted Patent US 10,472,650
Granted Patent B2
US 10,472,650 · App. 15/551,869 · Granted Nov 12, 2019

Methods and compositions for treating genetic eye diseases

Inventors: Beverly L Davidson (Iowa City, IA); Yong Hong Chen (Iowa City, IA); Alberto Auricchio (Naples, IT)
Assignee: University of Iowa Research Foundation
C12N15/8616A61K48/0058A61P27/00C07K14/005C12N15/86A61K48/0008C12N2750/14122C12N2750/14145C12N2810/50
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 10,472,650
App. No.
15/551,869
Granted
Nov 12, 2019
Kind
B2
Abstract

The present disclosure provides targeting peptides and vectors containing a sequence that encodes targetting peptides that deliver agents, to the eye. The present inventors have discovered peptides that function to target agents, such as viral vectors, to ocular cells. The present disclosure describes a method to utilize these novel peptides to direct, for example, viral capsids to the cell type of interest. In this instance, ocular cells (such as retinal cells) are targeted by the identified peptides. Vectors harboring capsid proteins modified to include such peptides can be used to provide therapeutic agents to the eye.

Claims (21)

1. A modified adeno-associated virus (AAV) capsid protein comprising an ocular cell targeting peptide, wherein the targeting peptide comprises a sequence up to 10 amino acids in length that comprises GSTPPPM (SEQ ID NO: 1), in an amino to carboxy orientation or in a carboxy to amino orientation, and wherein the targeting peptide targets an AAV to an ocular cell.

2. The capsid protein of claim 1 , wherein the targeting peptide is 8 or 9 amino acids in length.

3. The capsid protein of claim 1 , wherein the targeting peptide is inserted between the capsid residues at AAV2 capsid positions P34-A35, T138-A139, A139-P140, G453-T454, N587-R588, and/or R588-Q589 of SEQ ID NO:8.

4. The capsid protein of claim 1 , wherein the targeting peptide is inserted after the capsid residues at AAV9 capsid positions D384, G385, I560, T561, N562, E563, E564, E565, N704, and/or Y705 of SEQ ID NO:11.

5. The capsid protein of claim 1 , wherein the capsid protein comprises or consists of SEQ ID NO:9.

6. The capsid protein of claim 1 , wherein the targeting peptide targets a diseased ocular cell.

7. The capsid protein of claim 6 , wherein the targeting peptide targets an ocular cell in a subject that has retinitis pigmentosa, maculopathies, Leber's congenital amaurosis, early onset severe retinal dystrophy, achromatopsia, retinoschisis, ocular albinism, oculocutaneous albinism, glaucoma, Stargardt disease, choroideremia, age-related macular degeneration, Spinocerebellar Ataxia type 7 (SCAT), color blindness, or lysosomal storage diseases that affect the cornea.

8. The capsid protein of claim 1 , wherein the AAV capsid is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVRh74 (Rhesus macaque-derived AAV), AAVRh10, or modified capsids of these serotypes.

9. A nucleic acid sequence encoding the modified capsid as described in claim 1 .

10. The nucleic acid sequence of claim 9 , comprising the nucleic acid sequence GGGTCGACGCCGCCTCCTATG (SEQ ID NO:2).

11. A viral vector particle comprising the capsid protein of claim 1 .

12. The viral vector particle of claim 11 , wherein the viral vector particle further comprises a nucleic acid sequence encoding a nucleic acid of interest.

13. The viral vector particle of claim 12 , wherein the nucleic acid of interest is a therapeutic agent.

14. The viral vector particle of claim 13 , wherein the therapeutic agent is an enzyme or an RNAi molecule.

15. The viral vector particle of claim 13 , wherein the therapeutic agent is Ataxin 7 miRNA, Retinal pigment epithelium-specific 65 kDa protein (RPE 65), vascular endothelial growth factor (VEGF) inhibitor, soluble VEGF receptor 1 (sFLT1) (Rab escort protein-1) REP1, L-opsin, rhodopsin (Rho), phosphodiesterase 6B (PDE6B), ATP-binding cassette sub-family A member 4 (ABCA4), lecithin retinol acyltransferase (LRAT), Retinal degeneration slow/Peripherin (RDS/Peripherin), Tyrosine-protein kinase Mer (MERTK), Inosine-5 prime-monophosphate dehydrogenase type I (IMPDHI), guanylate cyclase 2D (GUCY2D), aryl-hydrocarbon interacting protein-like 1 (AIPL 1), retinitis pigmentosa GTPase regulator interacting protein 1 (RPGRIP1), guanine nucleotide binding protein alpha transducing activity polypeptide 2 (GNAT2), cyclic nucleotide gated channel beta 3 (CNGB3), retinoschisin 1 (Rs1), ocular albinism type 1 (OA1), oculocutaneous albinism type 1 (OCA1) tyrosinase, P21 WAF-1/Cipl, platelet-derived growth factor (PDGF), Endostatin, Angiostatin, arylsulfatase B, or beta-glucuronidase.

16. A pharmaceutical composition comprising the viral vector particle of claim 11 and a pharmaceutically acceptable carrier.

17. An isolated host cell transduced by or comprising the viral vector particle of claim 11 .

18. A method of treating an ocular disease in a mammal comprising administering the viral vector of claim 11 to the mammal.

19. A method to deliver an agent to the eye of a subject, comprising transducing ocular cells with the viral vector of claim 11 so that the transduced ocular cells express the therapeutic agent and deliver the agent to the eye of the subject.

20. The method of claim 19 , wherein the transduced ocular cells are within or comprise retina outer plexiform layer (OPL).

21. The capsid protein of claim 6 , wherein the targeting peptide targets an ocular cell in a subject that has Mucopolysaccharidosis (MPS) IV and MPS VII.

Assignments (2)
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Jul 1, 2019
From: DAVIDSON, BEVERLY L.; CHEN, YONG HONG
To: UNIVERSITY OF IOWA RESEARCH FOUNDATION
Reel/Frame 049643/0084 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Jul 1, 2019
From: AURICCHIO, ALBERTO
To: FONDAZIONE TELETHON
Reel/Frame 049643/0172 →
Continuity (2)
Provisional Application 62118934 · Feb 20, 2015
Related Publication 20180142259A1 · May 24, 2018
Cited By (2)
US 12,653,910 US 12,734,252