Use of interfering RNA in the production of transgenic animals
The invention provides cells and animals, as well as methods of producing cells and animals, that express at least one interfering RNA molecule to regulate the expression of a specific gene or family of genes. The invention further provides novel iRNA molecules, as well as DNA templates for producing iRNA molecules.
1. A heritable DNA template encoding iRNA molecules that regulate the expression of a porcine endogenous retrovirus (PERV) family of genes wherein:
(i) the heritable DNA template encodes at least two iRNA molecules that can stably integrate into the genome of a porcine cell;
(ii) at least one of the iRNA molecules is homologous to
(a) the following pol sequence of PERV: GTAGAGACTTACTGACCAA (SEQ ID NO. 244) or a complement thereof: or
(b) the following gag sequence of PERV: GTTAGATCCAGGGCTCATAAT (SEQ ID NO. 211) or a complement thereof; and
(iii) PERV gene expression is functionally eliminated by the iRNA molecules in porcine cells and animals infected by PERV.
2. The heritable DNA template of claim 1 , wherein the at least two iRNA molecules target the same region of a gene.
3. The heritable DNA template of claim 1 , wherein the at least two iRNA molecules target at least two different regions of the same gene.
4. The heritable DNA template of claim 1 , wherein the iRNA molecules bind to a PERV selected from the group consisting of PERV-A, PERV-B and PERV-C.
5. The heritable DNA template of claim 1 , wherein the iRNA molecules bind to PERV-A and PERV-B.
6. The heritable DNA template of claim 1 wherein the iRNA molecules bind to PERV-A and PERV-C.
7. The heritable DNA template of claim 1 wherein the iRNA molecules bind to PERV-B and PERV-C.
8. The heritable DNA template of claim 1 , wherein an additional iRNA molecule targets the env region of the porcine endogenous retrovirus.
9. The heritable DNA template of claim 1 , wherein at least one of the iRNA molecules is homologous to the following gag sequence: GTTAGATCCAGGGCTCATAAT (SEQ ID NO. 211), or a complement thereof.
10. The heritable DNA template of claim 1 , wherein at least one of the iRNA molecules is homologous to the following pol sequence: GTAGAGACTTACTGACCAA (SEQ ID NO. 244), or a complement thereof.
11. The heritable DNA template of claim 1 , wherein the iRNA molecules target the pol, env and gag region of the porcine endogenous retrovirus.
12. The heritable DNA template of claim 1 , wherein at least one of the iRNA molecules is homologous to the following gag sequence: GTTAGATCCAGGGCTCATAAT (SEQ ID NO. 211), or a complement thereof; and wherein at least one of the iRNA molecules is homologous to the following pol sequence GTAGAGACTTACTGACCAA(SEQ ID NO. 244), or a complement thereof.
13. A heritable DNA template encoding iRNA molecules that regulate the expression of a family of genes wherein:
(i) the heritable DNA template encodes at least two iRNA molecules that can stably integrate into the genome of a porcine cell;
(ii) the iRNA molecules are homologous to a conserved sequence of a gag region of porcine endogenous retrovirus (PERV) genes;
(iii) the iRNA molecules target the following gag sequence of PERV: GTTAGATCCAGGGCTCATAAT (SEQ ID NO. 211), or a complement thereof; and
(iv) PERV gene expression is functionally eliminated by the iRNA molecules in porcine cells and animals infected by PERV.
14. A heritable DNA template encoding iRNA molecules that regulate the expression of a family of genes wherein:
(i) the heritable DNA template encodes at least two iRNA molecules that can stably integrate into the genome of a porcine cell;
(ii) the iRNA molecules are homologous to a conserved sequence of a pol region of porcine endogenous retrovirus (PERV) genes;
(iii) the iRNA molecules target the following pol sequence of PERV: GTAGAGACTTACTGACCAA (SEQ ID NO. 244) or a complement thereof; and
(iv) PERV gene expression is functionally eliminated by the iRNA molecules in porcine cells and animals infected by PERV.
15. A heritable DNA template encoding iRNA molecules that regulate the expression of a family of genes wherein:
(i) the heritable DNA template encodes at least two iRNA molecules that can stably integrate into the genome of a porcine cell;
(ii) at least one iRNA molecule is homologous to the following pol sequence of PERV: GTAGAGACTTACTGACCAA (SEQ ID NO. 244) or a complement thereof;
(iii) at least one iRNA molecule is homologous to the following gag sequence of PERV: GTTAGATCCAGGGCTCATAAT (SEQ ID NO. 211) or a complement thereof; and
(iv) PERV gene expression is functionally eliminated by the iRNA molecules in porcine cells and animals infected by PERV.