Second strand direct
Methods and compositions are provided herein for preparing high-throughput cDNA sequencing libraries.
1. A method of sequencing a sequencing platform specific cDNA amplicon comprising:
providing the sequencing platform specific amplicon, wherein the sequencing platform specific amplicon comprises a double-stranded polynucleotide comprising:
i) a first end comprising SEQ ID NO:1;
ii) a second end comprising SEQ ID NO:2; and
iii) a middle region comprising a double-stranded cDNA polynucleotide comprising a first strand cDNA polynucleotide complementary to an mRNA sequence hybridized to a second strand cDNA polynucleotide that corresponds to the mRNA sequence; and
sequencing the amplicon from the second end with a second sequencing primer comprising SEQ ID NO:8.
2. The method of claim 1 , wherein the first end comprises a 3′ poly-A region of the second strand cDNA polynucleotide that corresponds to a 3′ polyadenylation region of the mRNA sequence.
3. The method of claim 2 , wherein the second strand cDNA polynucleotide has a length that is less than 90% of the length of a corresponding mRNA.
4. The method of claim 1 , wherein the method comprises sequencing the amplicon from the first end with a first sequencing primer and then sequencing the amplicon from the second end with the second sequencing primer.
5. The method of claim 4 , wherein the first sequencing primer comprises the sequence from 5′ to 3′ GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC (SEQ ID NO:9) or from 5′ to 3′ ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO:12).
6. The method of claim 1 , wherein the second sequencing primer comprises from 5′ to 3′ AGATGTGTATAAGAGACAG (SEQ ID NO:10).
7. The method of claim 1 , wherein the second sequencing primer comprises from 5′ to 3′ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG (SEQ ID NO:11).
8. A method of sequencing a plurality of sequencing platform specific cDNA amplicons comprising:
providing the plurality of sequencing platform specific amplicons, wherein the individual sequencing platform specific amplicons comprise a double-stranded polynucleotide comprising:
i) a first end comprising SEQ ID NO:1;
ii) a second end comprising SEQ ID NO:2; and
iii) a middle region comprising a double-stranded cDNA polynucleotide comprising a first strand cDNA polynucleotide complementary to an mRNA sequence hybridized to a second strand cDNA polynucleotide that corresponds to the mRNA sequence;
sequencing a portion of the amplicons from the second end with a second sequencing primer comprising SEQ ID NO:8; and
sequencing a portion of the amplicons from the second end with a third sequencing primer comprising from 5′ to 3′GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (SEQ ID NO:12).
9. The method of claim 8 , wherein the second sequencing primer comprises SEQ ID NO:11.