Oligonucleotide compounds for targeting huntingtin mRNA
This disclosure relates to novel huntingtin targets. Novel oligonucleotides for the treatment of Huntington's disease are also provided.
1. A recombinant adeno-associated virus (rAAV) vector comprising a nucleotide sequence that encodes an RNA duplex; wherein the RNA duplex comprises a sense strand and an antisense strand; wherein the antisense strand is between 16 and 22 nucleotides in length and comprises a region of complementarity; and wherein the region of complementarity in the antisense strand is complementary to at least 16 contiguous nucleotides of 5′ GCCUGCUAGCUCCAUGCUUA 3′ (SEQ ID NO: 17).
2. The rAAV vector of claim 1 , wherein the region of complementarity in the antisense strand is complementary to at least 17 contiguous nucleotides of SEQ ID NO: 17.
3. The rAAV vector of claim 1 , wherein the region of complementarity in the antisense strand is complementary to at least 18 contiguous nucleotides of SEQ ID NO: 17.
4. The rAAV vector of claim 1 , wherein the sense strand is between 16 and 22 nucleotides in length and comprises a nucleotide sequence which is at least 80% identical to SEQ ID NO: 17.
5. The rAAV vector of claim 1 , wherein the sense strand is between 17 and 22 nucleotides in length and comprises a nucleotide sequence which is at least 85% identical to SEQ ID NO: 17.
6. The rAAV vector of claim 1 , wherein the sense strand is between 18 and 22 nucleotides in length and comprises a nucleotide sequence which is at least 90% identical to SEQ ID NO: 17.
7. The rAAV vector of claim 1 , wherein the antisense strand comprises a nucleotide sequence which is at least 85% identical to 5′ UAAGCAUGGAGCUAGCAGGC 3′ (SEQ ID NO: 328).
8. The rAAV vector of claim 1 , wherein the antisense strand comprises a nucleotide sequence which is at least 90% identical to 5′ UAAGCAUGGAGCUAGCAGGC 3′ (SEQ ID NO: 328).
9. The rAAV vector of claim 1 , wherein the antisense strand comprises a nucleotide sequence which is at least 85% identical to 5′ UAAGCAUGGAGCUAGCAGGC 3′ (SEQ ID NO: 328); and wherein the sense strand is between 17 and 22 nucleotides in length and comprises a nucleotide sequence which is at least 85% identical to SEQ ID NO: 17.
10. The rAAV vector of claim 1 , wherein the antisense strand comprises a nucleotide sequence which is at least 90% identical to 5′ UAAGCAUGGAGCUAGCAGGC 3′ (SEQ ID NO: 328); and wherein the sense strand is between 18 and 22 nucleotides in length and comprises a nucleotide sequence which is at least 90% identical to SEQ ID NO: 17.
11. A recombinant adeno-associated virus (rAAV) comprising the rAAV vector of claim 1 and an AAV capsid.
12. A pharmaceutical composition comprising the rAAV of claim 11 and a pharmaceutically acceptable carrier.
13. A recombinant adeno-associated virus (rAAV) comprising the rAAV vector of claim 10 and an AAV capsid.
14. A pharmaceutical composition comprising the rAAV of claim 13 and a pharmaceutically acceptable carrier.
15. A method for inhibiting expression of HTT gene in a cell, the method comprising introducing into the cell the rAAV vector of claim 1 .
16. A method for inhibiting expression of HTT gene in a cell, the method comprising introducing into the cell the rAAV vector of claim 10 .
17. A method of treating Huntington's Disease in a patient, the method comprising administering to the patient a therapeutically effective amount of the rAAV of claim 11 .
18. The method of claim 17 , wherein the rAAV is administered to a putamen of the patient.
19. The method of claim 17 , wherein the rAAV is administered to one or more regions of the parenchyma of the brain, with at least one region being a putamen.
20. The method of claim 17 , wherein administering the rAAV to the patient causes a decrease in HTT gene mRNA in the striatum, the cortex, or both the striatum and the cortex of the patient.
21. A method of treating Huntington's Disease in a patient, the method comprising administering to the patient a therapeutically effective amount of the rAAV of claim 13 .
22. The method of claim 21 , wherein the rAAV is administered to a putamen of the patient.
23. The method of claim 21 , wherein the rAAV is administered to one or more regions of the parenchyma of the brain, with at least one region being a putamen.
24. The method of claim 21 , wherein administering the rAAV to the patient causes a decrease in HTT gene mRNA in the striatum, the cortex, or both the striatum and the cortex of the patient.
25. The method of claim 15 , wherein the cell is:
(i) a CNS cell;
(ii) a neuronal cell or an astrocyte; or
(iii) in a patient.
26. The method of claim 25 , wherein the patient has Huntington's Disease.
27. The rAAV vector of claim 1 , wherein the sense strand, the antisense strand, or both the sense strand and the antisense strand, are each 21 nucleotides in length.
28. The rAAV vector of claim 1 , wherein the sense strand and the antisense strand comprise at least one mismatched base pair.
29. The rAAV vector of claim 28 , wherein the mismatched base pair is present between the 5′ end of the antisense strand and the 3′ end of the sense strand.
30. The rAAV vector of claim 1 , wherein the sense strand, the antisense strand, or both the sense strand and the antisense strand comprise a 3′ overhang of at least 1 or 2 nucleotides.