RNA-guided human genome engineering
A method of altering a eukaryotic cell is provided including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
1. A method of altering a eukaryotic cell comprising
transfecting the eukaryotic cell with a nucleic acid encoding a guide RNA complementary to genomic DNA of the eukaryotic cell,
transfecting the eukaryotic cell with a nucleic acid encoding a Cas9 enzyme that interacts with the guide RNA and cleaves the genomic DNA in a site specific manner,
wherein the eukaryotic cell expresses the guide RNA and the Cas9 enzyme, the guide RNA binds to complementary genomic DNA and the Cas9 enzyme cleaves the genomic DNA in a site specific manner;
wherein the guide RNA includes a guide sequence complementary to the genomic DNA and a gRNA scaffold sequence connected to the guide sequence and the gRNA scaffold sequence comprising the following nucleic acid sequence
(SEQ ID NO: 46)
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA
ACUUGAAAAAGUGGCACCGAGUCGGUGC.
2. The method of claim 1 wherein the eukaryotic cell is a yeast cell, a plant cell or a mammalian cell.
3. The method of claim 1 wherein the eukaryotic cell is a human cell.
4. The method of claim 1 wherein the eukaryotic cell is transfected with
a plurality of nucleic acids encoding guide RNAs complementary to different sites on genomic DNA of the eukaryotic cell,
wherein each of the guide RNAs includes a guide sequence complementary to the genomic DNA and a gRNA scaffold sequence connected to the guide sequence and the gRNA scaffold sequence comprising the following nucleic acid sequence
(SEQ ID NO: 46)
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA
ACUUGAAAAAGUGGCACCGAGUCGGUGC.
and
wherein the cell expresses the guide RNAs and the Cas9 enzyme, the guide RNAs bind to the different sites on the genomic DNA and the Cas9 enzyme cleaves the different sites on the genomic DNA in a site specific manner.
5. The method of claim 1 wherein the guide RNA includes between 100 to 250 nucleotides.
6. The method of claim 1 wherein the Cas9 enzyme is encoded by a human codon-optimized nucleic acid.
7. The method of claim 1 wherein the Cas9 enzyme includes a nuclear localization signal.
8. The method of claim 1 wherein the eukaryotic cell is a stem cell.
9. The method of claim 1 wherein the eukaryotic cell is a human stem cell.
10. The method of claim 9 wherein a donor nucleic acid is hybridized to the guide RNA.
11. The method of claim 1 wherein the eukaryotic cell is a human induced pluripotent stem cell.
12. The method of claim 1 wherein the Cas 9 enzyme is an S. pyogenes Cas 9 enzyme.
13. The method of claim 1 wherein the eukaryotic cell is transfected with
a plurality of nucleic acids encoding guide RNAs complementary to different sites on genomic DNA of the eukaryotic cell,
wherein each of the guide RNAs includes a guide sequence complementary to the genomic DNA and a gRNA scaffold sequence connected to the guide sequence and the gRNA scaffold sequence comprising the following nucleic acid sequence
(SEQ ID NO: 46)
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA
ACUUGAAAAAGUGGCACCGAGUCGGUGC.
and
wherein the cell expresses the guide RNAs and the Cas9 enzyme, the guide RNAs bind to the different sites on the genomic DNA and the Cas9 enzyme cleaves the different sites on the genomic DNA in a site specific manner, and
an intervening nucleic acid sequence between the different sites on the genomic DNA is deleted.
14. The method of claim 1 wherein the Cas9 enzyme cleaves the genomic DNA and a donor nucleic acid provided to the eukaryotic cell is inserted into the genomic DNA.
15. The method of claim 1 wherein the Cas9 enzyme cleaves the genomic DNA whereby a nucleotide is deleted or inserted.
16. The method of claim 1 wherein the Cas9 enzyme cleaves the genomic DNA whereby expression of the genomic DNA is altered.
17. A method of modulating expression of genomic DNA in a eukaryotic cell comprising
transfecting the eukaryotic cell with a nucleic acid encoding a guide RNA complementary to genomic DNA of the eukaryotic cell,
transfecting the eukaryotic cell with a nucleic acid encoding a Cas9 protein having inactive nuclease domains that interacts with the guide RNA and binds to the genomic DNA in a site specific manner,
wherein the eukaryotic cell expresses the guide RNA and the Cas9 protein,
wherein the Cas9 protein having inactive nuclease domains includes a transcriptional activator or repressor domain attached thereto for modulating target nucleic acid expression in vivo,
wherein the guide RNA and the Cas9 protein including the transcriptional activator or repressor domain co-localize to the genomic DNA and wherein the transcriptional activator or repressor domain modulates expression of the genomic DNA,
wherein the guide RNA includes a guide sequence complementary to the genomic DNA and a gRNA scaffold sequence comprising the following nucleic acid sequence
(SEQ ID NO: 46)
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA
ACUUGAAAAAGUGGCACCGAGUCGGUGC.
18. The method of claim 17 wherein the eukaryotic cell is a yeast cell, a plant cell or a mammalian cell.
19. The method of claim 17 wherein the eukaryotic cell is a human cell.
20. The method of claim 17 wherein the guide RNA sequence includes between 100 to 250 nucleotides.
21. The method of claim 17 wherein the Cas9 protein is encoded by a human codon-optimized nucleic acid.
22. The method of claim 17 wherein the Cas9 protein includes a nuclear localization signal.
23. The method of claim 17 wherein the eukaryotic cell is a stem cell.
24. The method of claim 17 wherein the eukaryotic cell is a human stem cell.
25. The method of claim 17 wherein the eukaryotic cell is a human induced pluripotent stem cell.
26. The method of claim 17 wherein the Cas 9 protein is an S. pyogenes Cas 9 protein.
27. A method of targeting a Cas 9 protein to genomic DNA in a eukaryotic cell comprising
transfecting the eukaryotic cell with a nucleic acid encoding a guide RNA complementary to genomic DNA of the eukaryotic cell,
transfecting the eukaryotic cell with a nucleic acid encoding a Cas9 protein that interacts with the guide RNA to form a guide RNA/Cas 9 protein complex bound to the genomic DNA,
wherein the eukaryotic cell expresses the guide RNA and the Cas9 protein,
wherein the guide RNA includes a guide sequence complementary to the target nucleic acid sequence and a gRNA scaffold sequence comprising the following nucleic acid sequence
(SEQ ID NO: 46)
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACU
UGAAAAAGUGGCACCGAGUCGGUGC.
28. The method of claim 27 wherein the eukaryotic cell is a yeast cell, a plant cell or a mammalian cell.
29. The method of claim 27 wherein the eukaryotic cell is a human cell.
30. The method of claim 27 wherein the guide RNA sequence includes between 100 to 250 nucleotides.
31. The method of claim 27 wherein the Cas9 protein is encoded by a human codon-optimized nucleic acid.
32. The method of claim 27 wherein the Cas9 protein includes a nuclear localization signal.
33. The method of claim 27 wherein the eukaryotic cell is a stem cell.
34. The method of claim 27 wherein the eukaryotic cell is a human stem cell.
35. The method of claim 27 wherein the eukaryotic cell is a human induced pluripotent stem cell.
36. The method of claim 27 wherein the Cas 9 protein is an S. pyogenes Cas 9 protein.