Subject-specific tumor inhibiting cells and the use thereof
This disclosure is directed to a pharmaceutical composition comprises tumor inhibiting cells (TICs) and a method for producing the TICs. The tumor inhibiting cells can be derived from immune cells including T cells, NK cells, or a combination thereof, modified to have inactivated Cbl-b gene alleles and free from Cbl-b bio-function (Cbl-b −/− TICs). The Cbl-b −/− TICs are free from deoxyribonucleic acids exogenous to the immune cells. The immune cells can be isolated using a portable cell isolation and modification device. This disclosure is further directed to a method for treating tumorous conditions in subjects. The pharmaceutical composition can provide a subject-specific tumor treatment.
1. A pharmaceutical composition comprising a population of Cbl-b −/− tumor inhibiting cells (Cbl-b −/− TICs) modified from immune cells, wherein the Cbl-b −/− TICs have inactivated Cbl-b genomic alleles and are free from Cbl-b bio-function, and wherein the Cbl-b −/− TICS are free from deoxyribonucleic acids exogenous to the immune cells and free from viral nucleic acids exogenous to the immune cells, wherein said immune cells are tumor infiltrating lymphocytes (TILs) from a tumor of a subject, a xenograft tumor derived from the tumor of said subject, or a combination thereof, and wherein said Cbl-b −/− TICs are specific to said tumor of said subject and have tumor specific cytotoxicity mediated via T cell receptor (TCR).
2. The pharmaceutical composition of claim 1 , wherein the Cbl-b −/− TICs comprise Cbl-b −/− T cells, Cbl-b −/− CD8 + T cells, Cbl-b −/− NK cells, or a combination thereof.
3. The pharmaceutical composition of claim 1 , wherein the Cbl-b −/− TICs are histological compatible to a subject.
4. The pharmaceutical composition of claim 3 , wherein the immune cells are from peripheral blood of the subject, lymph organs of the subject, lymph fluids of the subject, other organs of the subject, a tissue of the subject, or a combination thereof.
5. A method for producing Cbl-b −/− tumor inhibiting cells (TICs), the method comprising the steps of:
a) inactivating genomic Cbl-b genes of immune cells to produce the Cbl-b −/− TICs, wherein the Cbl-b −/− TICs are free from Cbl-b bio-function and free from deoxyribonucleic acids exogenous to the immune cells and free from viral nucleic acids exogenous to the immune cells, wherein said immune cells are tumor infiltrating lymphocytes (TILs) from a tumor of a subject, a xenograft tumor derived from the tumor of said subject, or a combination thereof, and wherein said Cbl-b −/− TICs are specific to said tumor of said subject and have tumor specific cytotoxicity mediated via T cell receptor (TCR);
b) optionally, propagating the Cbl-b −/− TICs in in vitro cell culture; and
c) optionally, harvesting the Cbl-b −/− TICs from the in vitro cell culture.
6. The method of claim 5 , wherein the genomic Cbl-b genes are inactivated by introducing into the immune cells a genomic modification component comprising a Cas9 protein and a sgRNA Cbl-b targeting the genomic Cbl-b genes of the immune cells, and wherein the genomic modification component is free from deoxyribonucleic acids exogenous to the immune cells and free from viral nucleic acids.
7. The method of claim 6 , wherein said sgRNA Cbl-b comprises a nucleic acid sequence GAGGUCCACCAGAUUAGCUCUGG (SEQ ID. 1), a nucleic acid sequence having homology in a range of from 80% to 100% to the sequence of said SEQ ID. 1, or a combination thereof.
8. The method of claim 5 , wherein the immune cells comprise unmodified T cells, unmodified NK cells, or a combination thereof.
9. The method of claim 5 , wherein immune cells comprise purified unmodified T cells.
10. The method of claim 5 , wherein said immune cells are tumor infiltrating Tcells isolated from said tumor of said subject, and optionally expanded, wherein said subject is a human subject.
11. The method of claim 5 , wherein the Cbl-b −/− TICs comprise Cbl-b −/− T cells, Cbl-b −/− CD8 + T cells, Cbl-b −/− NK cells, or a combination thereof.
12. The method of claim 5 , wherein the Cbl-b −/− TICs comprise in a range of from 10% to 100% of Cbl-b −/− T cells, percentage based on total population of the Cbl-b −/− TICs.
13. A method for treating a tumorous condition of a subject in need thereof, the method comprising the steps of:
a) inactivating genomic Cbl-b genes of immune cells of the subject to produce Cbl-b −/− tumor inhibiting cells (TICs), wherein the Cbl-b −/− TICs have inactivated Cbl-b gene alleles and are free from Cbl-b bio-function, and wherein the Cbl-b −/− TICs are free from deoxyribonucleic acids exogenous to the immune cells and free from viral nucleic acids exogenous to the immune cells, wherein said immune cells are tumor infiltrating lymphocytes (TILs) from a tumor of said subject, a xenograft tumor derived from the tumor of said subject, or a combination thereof, and wherein said Cbl-b −/− TICs are specific to said tumor of said subject and have tumor specific cytotoxicity mediated via T cell receptor (TCR);
b) optionally, propagating the Cbl-b −/− TICs in in vitro cell culture; and
c) administering the Cbl-b −/− TICs to the subject.
14. The method of claim 13 , wherein the genomic Cbl-b genes are inactivated by introducing into the immune cells a genomic modification component comprising a Cas9 protein and a sgRNA Cbl-b targeting the genomic Cbl-b genes of the immune cells, and wherein the genomic modification component is free from deoxyribonucleic acids exogenous to the immune cells and free from viral nucleic acids.
15. The method of claim 14 , wherein the Cas9 protein is a modified recombinant Cas9 protein comprising a C-Terminal nuclear localization signal region from an unmodified Cas9 protein.
16. The method of claim 13 , wherein the Cbl-b −/− TICs comprise Cbl-b −/− T cells, Cbl-b −/− CD8 + T cells, Cbl-b −/− NK cells, or a combination thereof, wherein the immune cells are from peripheral blood of the subject, lymph organs of the subject, lymph fluids of the subject, or a combination thereof, or a combination thereof and wherein said subject is a human subject.
17. The method of claim 13 , wherein said subject has two or more different tumors.
18. The method of claim 13 , wherein the number of Cbl-b −/− TICs administered to the subject is in a range of from about 1×10 5 to about 5×10 7 cells/kg and wherein said Cbl-b −/− TICs are administrated to the subject by injection, infusion or a combination thereof.
19. The method of claim 13 , further comprising administering to said subject a cancer drug, a checkpoint inhibitor, or a combination thereof.