Multi-armed polyrotaxane platform for protected nucleic acid delivery

1. A polyrotaxane carrier for in vivo delivery of a nucleic acid, said carrier comprising:

a multi-arm polyethylene glycol (PEG) backbone comprising 4 arms;

at least one cyclic compound having a cavity, where an arm of said multi-arm PEG backbone is threaded into the cavity of said cyclic compound forming an inclusion complex;

a bulky moiety capping the terminal of the arm(s) threaded into said cyclic compound where said moiety inhibits dethreading of the cyclodextrin from the arm(s) of said backbone;

where two arms of said PEG backbone are free of cyclic compounds; and

where said carrier has a net positive charge.

2. The carrier of claim 1 , wherein:

said PEG backbone has a molecular weight ranging from about 1.0 to about 10 kDA per arm; and/or

said PEG backbone comprise about 22 to about 227 ethylene oxides per arm; and/or

said PEG backbone has a molecular weight of about 2.5 kDa per arm.

3. The carrier of claim 1 , wherein:

the arm(s) threaded into said cyclic compound(s) each bear on average from about 5 to about 110 cyclic compounds; and/or

the arm(s) threaded into said cyclic compound(s) each bear, on average, about 20 cyclic compounds per arm.

4. The carrier of claim 1 , wherein:

said cyclic compound comprise a compound selected from the group consisting of a cyclodextrin, a crown ether, a cucurbituril and a cyclofructan; and/or

said cyclic compound comprises a cyclodextrin; and/or

said cyclic compound comprises a cyclodextrin selected from the group consisting of an α-cyclodextrin, a ß-cyclodextrin, a γ-cyclodextrin, a hydroxypropylated α-cyclodextrin, a hydroxypropylated ß-cyclodextrin, a hydroxypropoylated γ-cyclodextrin, a dimethylcyclodextrin, a chemically modified cyclodextrin (e.g., carboxyl modified cyclodextrin); and/or

said cyclic compound comprises a cucurbituril; and/or

said cyclic compound comprises a cucurbituril selected from the group consisting of cucurbit[5]uril, cucurbit[6]uril, cucurbit[7]uril, cucurbit[8]uril, cucurbit[9]uril, cucurbit[10]uril, and a chemically modified cucubituril; and/or

said cyclic compound comprises a cucurbit[6]uril (CB[6]).

5. The carrier of claim 1 , wherein:

said cyclic compound(s) are substituted with one or more nucleophilic groups; and/or

said cyclic compound(s) are substituted with one or more amine groups or groups derived from an amine group; and/or

said cyclic compound(s) are substituted with one or more groups selected from the group consisting of a primary amine, a secondary amine, a tertiary amine, and an imine group; and/or

said cyclic compound(s) are substituted with one or more primary amines; and/or

the number of nucleophilic group substituted on the cyclic compound(s) ranges from 1 up to about 20 substitutions per cyclic compound; and/or

the cyclic compounds are substituted with nucleophilic groups to provide a positive zeta potential for said carrier ranging from about +1V or from about +5 mV up to about +50 m V, or up to about +25 mV.

6. The carrier of claim 1 , wherein:

the bulky moiety capping the terminal of the arm(s) threaded into said cyclic compound(s) comprises a compound having a 3 dimensional size greater than the internal diameter of the cyclic compound(s); and/or

the bulky moiety capping the terminal of the arm(s) threaded into said cyclic the bulky moiety capping the terminal of the arm(s) threaded into said cyclic compound(s) comprises a moiety selected from the group consisting of Z-tyrosine, phenylalanine, a group having at least one benzene ring, and a group having at least one tertiary butyl; and/or

the bulky moiety capping the terminal of the arm(s) threaded into said cyclic the bulky moiety capping the terminal of the arm(s) threaded into said cyclic compound(s) comprises a moiety selected from the group consisting of a Z-tyrosine, phenylaline, a benzyloxycarbonyl (Z) group, a 9-fluorenylmethyloxycarbonyl (Fmoc) group, a benzyl ester (OBz) group, a tertiary butylcarbonyl (Boc) group, and an amino acid-tertiary butyl ester (OBu) group; and/or

the bulky moiety capping the terminal of the arm(s) threaded into said cyclic compound(s) comprises a Z-tyrosine.

7. A polyrotaxane carrier for in vivo delivery of a nucleic acid, said carrier comprising:

a multi-arm polyethylene glycol (PEG) backbone comprising at least three arms;

at least one cyclic compound having a cavity, where an arm of said multi-arm PEG backbone is threaded into the cavity of said cyclic compound forming an inclusion complex;

a bulky moiety capping the terminal of the arm(s) threaded into said cyclic compound where said moiety inhibits dethreading of the cyclodextrin from the arm(s) of said backbone;

where at least one arm of said PEG backbone is free of cyclic compounds;

where said carrier has a net positive charge;

where:

at least one arm not threaded into said cyclic compound is terminated with a protecting group, and/or a fluorophore, and/or a targeting moiety; and/or

at least one arm not threaded into said cyclic compound are terminated with a protecting group selected from the group consisting of dansyl, acetyl, amide, and 3 to 20 carbon alkyl groups, Fmoc, Tboc, 9-fluoreneacetyl group, 1-fluorenecarboxylic group, 9-florenecarboxylic group, 9-fluorenone-1-carboxylic group, benzyloxycarbonyl, Xanthyl (Xan), Trityl (Trt), 4-methyltrityl (Mtt), 4-methoxytrityl (Mmt), 4-methoxy-2,3,6-trimethyl-benzenesulphonyl (Mtr), Mesitylene-2-sulphonyl (Mts), 4,4-dimethoxybenzhydryl (Mbh),Tosyl (Tos), 2,2,5,7,8-pentamethyl chroman-6-sulphonyl (Pmc), 4-methylbenzyl (MeBzl), 4-methoxybenzyl (MeOBzl), Benzyloxy (BzlO), Benzyl (Bzl), Benzoyl (Bz), 3-nitro-2-pyridinesulphenyl (Npys), 1-(4,4-dimentyl-2,6-diaxocyclohexylidene)ethyl (Dde), 2,6-dichlorobenzyl (2,6-DiCl-Bzl), 2-chlorobenzyloxycarbonyl (2-Cl-Z), 2-bromobenzyloxycarbonyl (2-Br-Z), Benzyloxymethyl (Bom), t-butoxycarbonyl (Boc), cyclohexyloxy (cHxO),t-butoxymethyl (Bum), t-butoxy (tBuO), t-Butyl (tBu), Acetyl (Ac), and Trifluoroacetyl (TFA); and/or

at least one arm not threaded into said cyclic compound is attached to a fluorophore; and/or

at least one arm not threaded into said cyclic compound is attached to a targeting moiety that specifically or preferentially binds to a cell; and/or

at least one arm not threaded into said cyclic compound is attached to a at least one arm not threaded into said cyclic compound is attached to a targeting moiety selected from the group consisting of an antibody, a receptor ligand, a nucleic acid aptamer, a peptide aptamer, neural cell adhesion molecule (NCAM), a cell penetrating peptide (CPP), a peptide aptamer, and a lectin; and/or

at least one arm not threaded into said cyclic compound is attached to a at least one arm not threaded into said cyclic compound is attached to a targeting moiety comprising a ligand that binds a receptor where said ligand is selected from the group consisting of transferrin, mannose, glucose, and folic acid; and/or

at least one arm not threaded into said cyclic compound is attached to a targeting moiety comprising transferrin.

8. The carrier of claim 1 , wherein:

said bulky moiety is attached to an arm of said backbone by a cleavable linkage; and/or

said one or more nucleophilic groups are attached to said cyclic compounds by a cleavable linkage.

9. The carrier of claim 1 , wherein:

said carrier is complexed with a nucleic acid; and/or

said carrier is complexed with an RNA; and/or

said carrier is complexed with a DNA; and/or

said carrier is complexed with a plasmid; and/or

said carrier is complexed with a plasmid that encodes a heterologous gene or cDNA; and/or

said carrier is complexed with a plasmid that encodes a class 2 CRISPR/Cas endonuclease and a guide RNA; and/or

the N/P ratio of said carrier complexed to a nucleic acid ranges from about 0.01:1 up to about 100:1, or from about 2:1 up to about 50:1, or up to about 40:1, or up to about 30:1, or up to about 25:1, or ranges from about 2:1 up to about 25:1; and/or

the N/P ratio of said carrier complexed to a nucleic acid is about 10:1.

10. A pharmaceutical formulation comprising:

a polyrotaxane carrier of claim 7 ; and

a pharmaceutically acceptable carrier.

11. A construct for the treatment of Duchenne Muscular Dystrophy, said construct comprising:

a polyrotaxane carrier comprising:

a multi-arm polyethylene glycol (PEG) backbone comprising at least three arms;

at least one cyclic compound having a cavity, where an arm of said multi-arm PEG backbone is threaded into the cavity of said cyclic compound forming an inclusion complex;

a bulky moiety capping the terminal of the arm(s) threaded into said cyclic compound where said moiety inhibits dethreading of the cyclodextrin from the arm(s) of said backbone;

where at least one arm of said PEG backbone is free of cyclic compounds; and

where said carrier has a net positive charge; and

where said carrier is complexed with a plasmid encoding a class 2 CRISPR/Cas endonuclease, and a guide RNA that hybridizes to a target sequence within intron 44 of a mutant dystrophin gene, and/or a second CRISPR/Cas guide RNA guide sequence that hybridizes to a target sequence within intron 55 of the mutant dystrophin gene.

12. The construct of claim 11 , wherein:

the first CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a first target sequence corresponding to intron 44 of the human dystrophin gene, and/or

the second CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a second target sequence corresponding to intron 55 of the human dystrophin gene.

13. The construct of claim 11 , wherein:

the class 2 CRISPR/Cas endonuclease is a type II CRISPR/Cas endonuclease; and/or

the class 2 CRISPR/Cas endonuclease is a type II CRISPR/Cas endonuclease wherein the class 2 CRISPR/Cas endonuclease is a Cas9 protein and the corresponding CRISPR/Cas guide RNA is a Cas9 guide RNA; and/or

the guide sequence of the first CRISPR/Cas guide RNA comprises the 17 nucleotide sequence GAAAUUAAACUACACAC (SEQ ID NO:304) (SEQ ID NO:1158 in PCT/US2017/017255), and the guide sequence of the second CRISPR/Cas guide RNA comprises the 17 nucleotide sequence AUGAUGCUAUAAUACCA (SEQ ID NO:305) (SEQ ID NO:1177 in PCT/US2017/017255); and/or

the guide sequence of the first CRISPR/Cas guide RNA comprises the 20 nucleotide sequence GUUGAAAUUAAACUACACAC (SEQ ID NO:306) (SEQ ID NO:1153 in PCT/US2017/017255) and the guide sequence of the second CRISPR/Cas guide RNA comprises the 20 nucleotide sequence UGUAUGAUGCUAUAAUACCA (SEQ ID NO:307) (SEQ ID NO:1172 in PCT/US2017/017255).

14. A pharmaceutical formulation comprising:

a polyrotaxane construct of claim 11 ; and

a pharmaceutically acceptable carrier.

15. The carrier of claim 7 , wherein said carrier is complexed with a nucleic acid.

16. The carrier of claim 15 , wherein said carrier is complexed with a plasmid.

17. The carrier of claim 15 , wherein the N/P ratio of said carrier complexed to a nucleic acid ranges from about 0.01:1 up to about 100:1, or from about 2:1 up to about 50:1, or up to about 40:1, or up to about 30:1, or up to about 25:1, or ranges from about 2:1 up to about 25:1.

18. The carrier of claim 17 , wherein the N/P ratio of said carrier complexed to a nucleic acid is about 10:1.

19. The carrier of claim 1 , wherein:

said PEG backbone has a molecular weight ranging from about 1.0 to about 10 kDA per arm; and/or

said PEG backbone comprise about 22 to about 227 ethylene oxides per arm; and/or

said PEG backbone has a molecular weight of about 2.5 kDa per arm.

20. The carrier of claim 1 , wherein:

the arm(s) threaded into said cyclic compound(s) each bear on average from about 5 to about 110 cyclic compounds; and/or

the arm(s) threaded into said cyclic compound(s) each bear, on average, about 20 cyclic compounds per arm.

21. A pharmaceutical formulation comprising:

a polyrotaxane carrier of claim 1 ; and

a pharmaceutically acceptable carrier.