Methods and kits for amplification of double stranded DNA
Disclosed herein are devices and methods for amplifying double stranded DNA molecules. Methods for amplifying apoptotic cell-free DNA molecules can include performing end-repair and dA tailing of the cfDNA molecules, attachment of single-stranded hairpin adaptors to both ends of the end-repaired cfDNA molecules to produce adaptor-tagged, single-stranded, covalently closed DNA molecules, and amplification of the adaptor-tagged, single-stranded, covalently closed DNA molecules by a combination of rolling circle amplification and multiple displacement amplification using a PrimPol enzyme, a DNA polymerase with strand displacement activity and free nucleotides.
1. A method of amplifying DNA comprising:
a) providing linear double-stranded DNA molecules;
b) attaching single-stranded adaptors comprising a non-complementary region of fewer than 25 nucleotides and comprising an XTC priming sequence, wherein X is A, C, G or T, to both ends of the linear double-stranded DNA molecules to produce single-stranded, covalently closed DNA molecules; and
c) amplifying the single-stranded, covalently closed DNA molecules in a single operation by (i) rolling circle amplification and (ii) multiple displacement amplification.
2. The method of claim 1 , wherein the linear double-stranded DNA molecules comprise apoptotic cell-free DNA molecules.
3. The method of claim 1 , wherein the linear double-stranded DNA is derived from one or more bodily fluids from mammals.
4. The method of claim 1 , wherein providing the linear double-stranded DNA comprises end-repair and/or dA-tailing.
5. The method of claim 1 , wherein the adaptors have a hairpin structure.
6. The method of claim 1 , comprising attaching adaptors having the following sequence: 5′TAACATTTGTTGGCCACTCAGGCCAACAAATGTTAT3′ [SEQ ID NO:1].
7. The method of claim 1 , comprising:
providing apoptotic cell-free DNA molecules;
performing end repair and dA tailing of the cell-free DNA molecules; and
ligating hairpin adaptors comprising a dT overhang to the end repaired, dA tailed cell-free DNA molecules.
8. The method of claim 1 , wherein amplification is primed by a primase/polymerase.
9. The method of claim 1 , wherein amplification is primed by Thermus thermophilus primase/polymerase (TthPrimPol).
10. The method of claim 1 , wherein amplification comprises strand extension using a polymerase having strand displacement activity.
11. The method of claim 1 , wherein amplification comprises primase-initiated multiple displacement amplification.
12. The method of claim 1 , comprising using a primase/polymerase to generate primers on the DNA and using a polymerase having strand displacement activity to extend the primers.
13. The method of claim 12 , wherein the primase/polymerase comprises TthPrimPol and the polymerase comprises Phi29 polymerase.
14. The method of claim 1 , further comprising:
d) sequencing the amplified DNA.
15. The method of claim 14 , further comprising:
e) detecting one or a plurality of genetic variants in the sequenced, amplified DNA.
16. The method of claim 2 , wherein the apoptotic cell-free DNA molecules have a length between about 140 bp and 180 bp.
17. The method of claim 3 , wherein the bodily fluids comprise one or more of CSF, blood, plasma, serum, ascites, urine, saliva, tear drops, milk, semen and synovial fluid.
18. The method of claim 1 , wherein the XTC priming sequence is located in the loop portion of the adapter.
19. The method of claim 1 , wherein amplification is primed by human primase/polymerase (HsPrimPol).