IP Library › Granted Patent US 12,049,667
Granted Patent B2
US 12,049,667 · App. 16/616,424 · Granted Jul 30, 2024

High-throughput polynucleotide library sequencing and transcriptome analysis

Inventors: Stephen Jacob Goldfless (Seattle, WA); Adrian Wrangham Briggs (Seattle, WA); Rajagopal Chari (Seattle, WA); Yue Jiang (Seattle, WA); Ronald Hause (Seattle, WA); Francois Vigneault (Seattle, WA)
Assignee: ABvitro LLC
C12Q1/6855C12Q2525/155C12Q2525/179C12Q2525/191C12Q2563/159C12Q2563/179
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 12,049,667
App. No.
16/616,424
Granted
Jul 30, 2024
Kind
B2
Abstract

Provided herein are methods for target gene sequencing and single cell barcoding in conjunction with analysis of gene expression in single cells. In some embodiments, the target gene is an immune molecule, such as an antibody or TCR. In some embodiments, the methods can be used to carry out transcriptome sequencing, e.g., RNA sequencing, to capture transcriptome of single cells paired with full receptor immune receptor sequences such that information about the immune repertoire and transcriptome of a cell can be determined. Also provided are polynucleotide libraries for use in carrying out transcriptome analysis and immune molecule, e.g., antibody or TCR, sequencing.

Claims (71)

1. A method of producing a polynucleotide library, the method comprising:

(a) lysing a cell within each of a plurality of vessels, wherein each of said vessels comprises a cell from a population of cells and further comprises a plurality of molecular barcoded oligonucleotides, one or a pool of vessel barcoded oligonucleotides, and a first adaptor or a pool of first adaptors;

(b) producing, in each vessel, a plurality of complementary polynucleotides, said producing comprising:

(i) producing one or more target polynucleotide(s) that is complementary to one or more target polynucleotide transcript(s) present in the cell using one or more target-specific primers, wherein the one or more target polynucleotide(s) comprises a full-length coding sequence of a target gene; and

(ii) producing a collection of polynucleotides using random oligomer primers, wherein each of the polynucleotides in the collection of polynucleotides is individually complementary to a polynucleotide transcript in the cell;

(c) attaching to a plurality of the complementary polynucleotides one of the plurality of molecular barcoded oligonucleotides, thereby generating a plurality of molecular barcoded polynucleotides each comprising a molecular barcode;

(d) attaching one of the one or a pool of vessel barcoded oligonucleotides, or an amplified product thereof, and the first adaptor or one of the pool of first adaptors or an amplified product thereof, to a plurality of the molecular barcoded polynucleotides, thereby generating a plurality of dual-barcoded polynucleotides comprising a molecular barcode and a vessel barcode;

(e) producing a single-stranded amplicon of the plurality of dual-barcoded polynucleotides, thereby generating dual-barcoded single-stranded polynucleotides;

(f) adding a second adaptor to each of the single-stranded amplicons, wherein the first adaptor and second adaptor are present at or near opposite ends of each of the dual-barcoded single-stranded polynucleotides; wherein the first adaptor and/or second adaptor comprise at least one universal priming site;

(g) sequencing one or more target polynucleotide(s) from the plurality of barcoded polynucleotides; and

(h) sequencing the whole transcriptome or a portion thereof from the plurality of barcoded polynucleotides;

wherein sequence information from (g) and from (h) that have the same vessel barcode is identified as being from the same cell; and

wherein:

the complete transcriptome or a portion thereof is amplified prior to the sequencing, wherein amplification is carried out using a first primer set comprising a first primer and second primer specific for the first and second adaptor sequences, respectively;

the one or more target polynucleotide(s) from the plurality of barcoded polynucleotides is amplified prior to the sequencing, wherein the full-length sequence(s) of the one or more target polynucleotide(s) is amplified;

the cell origin of the one or more barcoded polynucleotide(s) is determined; and/or

the number of polynucleotides with the same barcode is quantitated or determined.

2. The method of claim 1 , wherein the collection of polynucleotides from each cell of the vessel, collectively, comprise sequences complementary to polynucleotide transcripts of a transcriptome or a partial transcriptome of each cell.

3. The method of claim 2 , wherein the transcriptome or partial transcriptome, collectively, comprises at least 60%, 70%, 75%, 80%, 85%, 90% 95%, 96%, 97%, 98%, 99% or 100% of the transcripts present in the cell.

4. The method of claim 1 , wherein: each of the dual-barcoded polynucleotides comprises a molecular barcode and a vessel barcode; and each of the dual-barcoded polynucleotides in the same vessel comprise the same vessel barcode.

5. The method of claim 1 , wherein the first adaptor contains a first universal priming site and the second adaptor contains a second universal priming site.

6. The method of claim 1 , wherein the first adaptor comprises the vessel barcoded oligonucleotide.

7. The method of claim 1 , wherein each of or one or more of the complementary polynucleotides of (b) is a cDNA.

8. The method of claim 1 , wherein each of or one or more of the barcoded single-stranded polynucleotide(s) is a strand of a cDNA.

9. The method of claim 5 , wherein adding the second adaptor comprises hybridizing a splint oligonucleotide to each of the dual-barcoded single-stranded polynucleotides in the presence of an oligonucleotide comprising the second universal priming site, wherein the splint oligonucleotide comprises (i) a sequence complementary to the second universal priming site and (ii) a degenerate overhang sequence capable of randomly annealing to the 3′ end of the barcoded single-stranded polynucleotide; and prior to the hybridizing, the splint oligonucleotide and the oligonucleotide comprising the second universal priming site are annealed to form a splint-adaptor duplex.

10. The method of claim 9 , wherein:

the degenerate overhang sequence comprises the sequence NNNNNN, wherein N is any nucleotide (SEQ ID NO:24);

the splint oligonucleotide comprises the sequence ACACGACGCTCTTCCGATCTNNNNNN, wherein Nis any nucleotide (SEQ ID NO:26); and/or

the oligonucleotide comprising the second universal priming site comprises the sequence AGATCGGAAGAGCGTCGTGT (SEQ ID NO:25).

11. The method of claim 1 , wherein the vessel barcode-oligonucleotide comprises a degenerate sequence or the sequence (N) 14-17 , wherein Nis any nucleotide.

12. The method of claim 1 , wherein each vessel comprises a pool of first adaptors that comprises a pool of vessel barcoded oligonucleotides, wherein each vessel barcoded oligonucleotide of the pool of first adaptors comprises at least one base-shift or base addition compared to at least one of the other vessel barcoded oligonucleotides in the pool.

13. The method of claim 1 , wherein in step (d) the method further comprises:

(i) amplifying the one or pool of vessel barcoded oligonucleotides; or amplifying the one or pool of the first adaptors, wherein the first adaptors comprise the one or pool of vessel barcoded oligonucleotides,

wherein the amplifying is performed prior to or simultaneously with attaching the vessel barcoded oligonucleotide; and/or

(ii) extending each of the plurality of the molecular barcoded polynucleotides after the attaching to generate the plurality of dual-barcoded polynucleotides.

14. The method of claim 1 , wherein, in step (b):

the one or more target polynucleotide(s) are produced by reverse transcription of the target polynucleotide transcript(s) in the presence of a reverse transcriptase and one or more target-specific primer(s) complementary to a target sequence of the target polynucleotide(s); and/or

the collection of polynucleotides are produced by reverse transcription of polynucleotide transcripts in the cell in the presence of a reverse transcriptase and one or more random oligomer primers complementary to a polynucleotide transcript in the cell, wherein the one or more random oligomer primers comprise a poly (T) sequence or a mixture of random hexamer oligonucleotide primers; and/or

producing the plurality of complementary polynucleotides comprises use of a non-template terminal transferase, wherein three or more non-template nucleotides, ribonucleotides or analogs thereof are added to the 3′ end of each produced complementary polynucleotide.

15. The method of claim 1 , wherein the one or more target polynucleotides comprises:

a first polynucleotide of a T-cell receptor alpha (TCRα) polynucleotide and a second polynucleotide of a T-cell receptor (TCRβ) polynucleotide;

a first polynucleotide of a T-cell receptor gamma (TCRγ) polynucleotide and a second polynucleotide of a T-cell receptor delta (TCRδ) polynucleotide; or

a first polynucleotide of a heavy chain immunoglobulin (IgH) polynucleotide and a second polynucleotide of a light chain immunoglobulin (IgL) polynucleotide.

16. The method of claim 1 , wherein the one or more target polynucleotide(s) and the collection of polynucleotides are produced in the vessel in the same reaction volume.

17. The method of claim 1 , wherein:

in step (b), producing the plurality of complementary polynucleotides comprises use of a non-template terminal transferase, wherein three or more non-template nucleotides, ribonucleotides or analogs thereof are added to the 3′ end of each produced complementary polynucleotide; and

in step (c), the attaching comprises hybridizing a region of one of the plurality of molecular barcoded oligonucleotides to the three or more non-template nucleotides of each of the complementary polynucleotides, wherein the plurality of molecular barcoded oligonucleotides are provided as a plurality of template switch oligonucleotides each comprising a 3′ portion complementary to the three or more non-template nucleotides; and/or the template switch oligonucleotide further comprises a 5′ terminal region that is complementary to a portion of the first adaptor, wherein the first adaptor comprises the vessel barcoded oligonucleotide.

18. The method of claim 1 , wherein the vessel is a well, an emulsion, a droplet, or a microcapsule.

19. The method of claim 1 , wherein the dual-barcoded single-stranded-polynucleotides comprise in order (5′ to 3′): the first adaptor, the vessel barcode, the molecular barcode and the second adaptor.

20. The method of claim 1 , wherein:

one or more of steps (a)-(f) is carried out in solution and/or is not carried out in the presence of a solid support.

21. The method of claim 1 , wherein the population of cells comprises at least or about at least 1×10 3 cells.

22. The method of claim 1 , wherein the population of cells comprises a lymphocyte or a subtype thereof, a B cell or a subtype thereof, a T cell or a subtype thereof, or a combination thereof.

23. The method of claim 1 , further comprising amplifying the plurality of dual-barcoded single-stranded polynucleotides, thereby generating a plurality of polynucleotide templates, wherein amplification of the plurality of dual-barcoded single-stranded polynucleotides is carried out in the presence of a first primer set comprising a first primer complementary to the first adaptor sequence and a second primer complementary to the second adaptor sequence.

24. The method of claim 1 , wherein one or more of the plurality of barcoded polynucleotides is sequenced.

25. The method of claim 24 , wherein:

the complete transcriptome or a portion thereof is amplified prior to the sequencing, wherein amplification is carried out using a first primer set comprising a first primer and second primer specific for the first and second adaptor sequences, respectively;

the one or more target polynucleotide(s) from the plurality of barcoded polynucleotides is amplified prior to the sequencing, wherein the full-length sequence(s) of the one or more target polynucleotide(s) is amplified;

the cell origin of the one or more barcoded polynucleotide(s) is determined; and/or

the number of polynucleotides with the same barcode is quantitated or determined.

26. The method of claim 1 , wherein transcriptome data from the plurality of cells is generated.

27. The method of claim 26 , wherein the transcriptome data comprise a parameter, characteristic, feature or phenotype associated with the function or activity of the cell; and/or the transcriptome data is associated with the activation, exhaustion or proliferation activity of the cell.

28. The method of claim 1 , further comprising:

(a) identifying the vessel barcode(s) associated with one of the target polynucleotide(s) sequenced in (g);

(b) identifying a selected single cell bearing the target polynucleotide; and

(c) generating transcriptome data from the selected target polypeptide-expressing cell.

29. The method of claim 1 , wherein the one or more target-specific primers comprises one or more primers complementary to a sequence(s) of the target sequence(s) of the target polynucleotide.

30. The method of claim 29 , wherein the one or more target-specific primers comprise primers to a target sequence of a plurality of target polynucleotides each encoding an immune molecule or a chain thereof.

31. The method of claim 11 , wherein at least one or two N in the sequence is W, wherein W is adenine or thymine.

32. The method of claim 1 , wherein at least steps (c) and (d) are carried out in solution and/or are not carried out in the presence of a solid support.

33. The method of claim 1 , wherein each of steps (a)-(e) is carried out in solution and/or is not carried out in the presence of a solid support.

Assignments (4)
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Mar 12, 2020
From: VIGNEAULT, FRANCOIS
To: ABVITRO LLC
Reel/Frame 052099/0407 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Jan 21, 2020
From: JUNO THERAPEUTICS, INC.
To: ABVITRO LLC
Reel/Frame 051574/0936 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Jan 21, 2020
From: CHARI, RAJAGOPAL; JIANG, YUE; HAUSE, RONALD JAMES, JR.
To: JUNO THERAPEUTICS, INC.
Reel/Frame 051574/0984 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Jan 21, 2020
From: GOLDFLESS, STEPHEN JACOB; BRIGGS, ADRIAN WRANGHAM
To: ABVITRO LLC; JUNO THERAPEUTICS, INC.
Reel/Frame 051575/0012 →
Continuity (2)
Provisional Application 62511949 · May 26, 2017
Related Publication 20200354784A1 · Nov 12, 2020