IP Library › Granted Patent US 12,084,703
Granted Patent B2
US 12,084,703 · App. 18/316,033 · Granted Sep 10, 2024

Synthetic self-amplifying mRNA molecules with secretion antigen and immunomodulator

Inventors: Yingzhong Li (Reading, MA); Libin Zhang (Lynnfield, MA)
Assignee: SunVax mRNA Therapeutics Inc.
C12P19/34C12N15/88
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 12,084,703
App. No.
18/316,033
Granted
Sep 10, 2024
Kind
B2
Abstract

Lipid nanoparticle (LNP) encapsulating self-amplifying mRNA, compositions, and methods of using the novel nucleic acid constructs and compositions are disclosed. LNP constructs include novel ionizable lipid. Novel sa-mRNA constructs encode a modified SARS-CoV-2 spike protein, wherein the polynucleotide has been truncated to not include nucleotides encoding a SARS-CoV-2 transmembrane domain and short cytosolic domain amino acids and immunomodulators. Sa-mRNAs are useful in for use as a therapeutic, diagnostic and/or prophylactic agent to mammalian cells or organs.

Claims (155)

1. An in vitro method of increasing the copy number of a nucleic acid comprising:

a) contacting cells with a nucleic acid encoding two expression units, the nucleic acid comprising:

i) an origin of replication sequence (Ori);

ii) a first expression unit encoding a first nucleotide sequence that is operably linked to a first promoter; and

iii) a second expression unit encoding a second nucleotide sequence that is operably linked to a second promoter, wherein the second promoter comprises an engineered T7 promoter comprising the nucleotide sequence of SEQ ID NO: 47 (TAATACGACTCACTATAGG) operably linked to a 5′ UTR and wherein the 5′ UTR is 3′ to SEQ ID NO: 47;

wherein the first expression unit encodes a selectable marker and the second expression unit encodes a self-amplifying mRNA (sa-mRNA);

b) selecting cells that express the selectable marker;

c) subculturing the selected cells to obtain a population of cells that express the selectable marker; and

d) propagating the population of cells to increase the copy number of the nucleic acid.

2. An in vitro method of increasing the copy number of a nucleic acid comprising:

a) contacting cells with a nucleic acid encoding two expression units, the nucleic acid comprising:

i) an origin of replication sequence (Ori);

ii) a first expression unit encoding a first nucleotide sequence that is operably linked to a first promoter; and

iii) a second expression unit encoding a second nucleotide sequence that is operably linked to a second promoter,

wherein the first expression unit encodes a selectable marker and the second expression unit encodes a self-amplifying mRNA (sa-mRNA);

b) selecting cells that express the selectable marker;

c) subculturing the selected cells to obtain a population of cells that express the selectable marker; and

d) propagating the population of cells to increase the copy number of the nucleic acid

wherein the nucleic acid has at least 90% sequence identity to SAM001 (SEQ ID NO: 35), SAM002 (SEQ ID NO: 36), SAM003 (SEQ ID NO: 37), SAM004 (SEQ ID NO: 38), SAM005 (SEQ ID NO: 39), SAM006 (SEQ ID NO: 40), MOD001 (SEQ ID NO: 41), or T7-VEE-GFP (SEQ ID NO: 42).

3. The in vitro method of claim 1 , wherein the first expression unit comprises the following operably linked nucleic acid sequence in a 5′ to 3′ direction or in a 3′ to 5′ direction:

Pr1-SM

wherein

Pr1 is the first promoter sequence, and

SM is the selectable marker.

4. The in vitro method of claim 1 , wherein the first promoter is an ampicillin resistance (AmpR) promoter, a kanamycin resistance (KanR) promoter, a chloramphenicol resistance (CamR) promoter, an erythromycin resistance (ErmR) promoter, and a tetracycline resistance (TetR) promoter, and/or wherein the selectable marker is AmpR, KanR, CamR, ErmR, or TetR.

5. The in vitro method of claim 1 , wherein the second expression unit comprises the following operably linked nucleic acid sequence from 5′ to 3′:

Pr2-5′UTR-nsP-SGP-GOI-3′UTR-PolyA

wherein

Pr2 is the second promoter sequence for in vitro transcription,

5′UTR is a 5′ untranslated region,

nsP is a plurality of non-structural replicase domain sequences,

SGP is a subgenomic promoter,

GOI is one or more genes of interest,

3′UTR is a 3′ untranslated region, and

Poly-A is a 3′ poly-adenylated tail (poly-A tail).

6. The in vitro method of claim 5 , wherein at least one gene of interest (GOI), encodes a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, an antigen, or a non-coding gene that encodes regulatory structures.

7. The in vitro method of claim 5 , wherein at least one GOI encodes a non-coding gene that encodes at least one regulatory structure, wherein the at least one regulatory structure is a small interfering RNA (siRNA), a micro-RNA (miRNA), a guide RNA (gRNA), a self-activating RNA (saRNA), a transfer RNA (tRNA), or a long intergenic non-coding (lincRNA).

8. The in vitro method of claim 1 , wherein at least one GOI encodes an infectious disease antigen, an allergic antigen, or a tumor antigen.

9. The in vitro method of claim 5 , wherein the plurality of non-structural replicase domain sequences are obtained from a Group IV positive single strand RNA virus selected from the group comprising Picornaviridae, Togaviridae, Coronaviridae, Hepeviridae, Caliciviridae, Flaviviridae, and Astroviridae.

10. The in vitro method of claim 5 , wherein the plurality of non-structural replicase domain sequences are obtained from an alphavirus selected from the group comprising Eastern Equine Encephalitis virus (EEE), Venezuelan Equine Encephalitis virus (VEE), Everglades virus, Mucambo virus, Pixuna virus, Western Equine Encephalitis virus (WEE), Sindbis virus, Semliki Forest virus, Middelburg virus, Chikungunya virus, O'nyong-nyong virus, Ross River virus, Barmah Forest virus, Getah virus, Sagiyama virus, Bebaru virus, Mayaro virus, Una virus, Aura virus, Whataroa virus, Babanki virus, Kyzylagach virus, Highlands J virus, Fort Morgan virus, Ndumu virus and Buggy Creek virus.

11. The in vitro method of claim 5 , wherein the plurality of non-structural replicase domain sequences are alphavirus nonstructural proteins 1-4 (nsP1-4).

12. The in vitro method of claim 5 , wherein the plurality of non-structural replicase domain sequences are obtained from the TC-83 strain of Venezuelan Equine Encephalitis virus (VEE).

13. The in vitro method of claim 1 , wherein the nucleic acid sequence comprises from 5′ to 3′:

a) Ori-SM-Pr1-L2-Pr2-5′UTR-nsP-L3-GOI-L4-3′UTR-PolyA;

b) L1-Ori-SM-Pr1-Pr2-5′UTR-nsP-L3-GOI-L4-3′UTR-PolyA

c) L1-Ori-SM-Pr1-L2-Pr2-5′UTR-nsP-GOI-L4-3′UTR-PolyA;

d) L1-Ori-SM-Pr1-L2-Pr2-5′UTR-nsP-L3-GOI-3′UTR-PolyA; or

e) L1-Ori-SM-Pr1-L2-Pr2-5′UTR-nsP-SGP-L3-GOI-L4-3′UTR-PolyA,

wherein

L1 is a first linker,

Ori is an origin of replication sequence,

SM is a selectable marker,

Pr1 is a first promoter sequence,

L2 is a second linker,

Pr2 is a second promoter sequence,

5′UTR is a 5′ untranslated region,

nsP is a plurality of non-structural replicase domain sequences,

L3 is a third linker,

SGP is a subgenomic promoter,

GOI is one or more genes of interest,

L4 is a fourth linker,

3′UTR is a 3′ untranslated region, and

Poly-A is a 3′ poly-adenylated tail (poly-A tail).

14. The in vitro method of claim 13 , wherein each of L1, L2, L3, and L4 is independently selected from a nucleic acid a sequence comprising

CGCGTGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCC

GGAACCGTAAAAAGGCCGCGTTGCTGGCGTT (SEQ ID NO: 43),

CACATTTCCCCGAAAAGTGCCACCTGAGCTC (SEQ ID NO: 44),

TTCGAAGGCGCGCCTCTAGAGCCACC (SEQ ID NO: 45),

or

CATCGATGATATCGCGGCCGCATACAGCAGC (SEQ ID NO: 46),

or

wherein L1 comprises SEQ ID NO: 43

(CGCGTGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGC

CAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTT);

L2 comprises SEQ ID NO: 44

(CACATTTCCCCGAAAAGTGCCACCTGAGCTC);

L3 comprises SEQ ID NO: 45

(TTCGAAGGCGCGCCTCTAGAGCCACC);

and

L4 comprises SEQ ID NO: 46

(CATCGATGATATCGCGGCCGCATACAGCAGC).

15. The in vitro method of claim 2 , wherein the second promoter comprises an engineered T7 promoter comprising the nucleotide sequence of SEQ ID NO: 47 (TAATACGACTCACTATAGG) operably linked to a 5′ UTR.

16. The in vitro method of claim 15 , wherein the 5′ UTR is 3′ to SEQ ID NO: 47 and wherein the 5′ UTR comprises nucleotide sequence ATAGG.

17. An in vitro method of increasing the copy number of a nucleic acid comprising:

a) contacting cells with a nucleic acid encoding two expression units, the nucleic acid comprising:

i) an origin of replication sequence (Ori);

ii) a first expression unit encoding a first nucleotide sequence that is operably linked to a first promoter; and

iii) a second expression unit encoding a second nucleotide sequence that is operably linked to a second promoter,

wherein the first expression unit encodes a selectable marker and the second expression unit encodes a self-amplifying mRNA (sa-mRNA); wherein the nucleic acid further comprises one or more linkers, wherein at least one of the one or more linkers comprises TTCGAAGGCGCGCCTCTAGAGCCACC (SEQ ID NO: 45);

b) selecting cells that express the selectable marker;

c) subculturing the selected cells to obtain a population of cells that express the selectable marker; and

d) propagating the population of cells to increase the copy number of the nucleic acid.

18. The in vitro method of claim 17 , wherein the first expression unit comprises the following operably linked nucleic acid sequence in a 5′ to 3′ direction or in a 3′ to 5′ direction:

Pr1-SM

wherein

Pr1 is the first promoter sequence, and

SM is the selectable marker.

19. The in vitro method of claim 17 , wherein the first promoter is an ampicillin resistance (AmpR) promoter, a kanamycin resistance (KanR) promoter, a chloramphenicol resistance (CamR) promoter, an erythromycin resistance (ErmR) promoter, and a tetracycline resistance (TetR) promoter, and/or wherein the selectable marker is AmpR, KanR, CamR, ErmR, or TetR.

20. The in vitro method of claim 17 , wherein the second expression unit comprises the following operably linked nucleic acid sequence from 5′ to 3′:

Pr2-5′UTR-nsP-SGP-GOI-3′UTR-PolyA

wherein

Pr2 is the second promoter sequence for in vitro transcription,

5′UTR is a 5′ untranslated region,

nsP is a plurality of non-structural replicase domain sequences,

SGP is a subgenomic promoter,

GOI is one or more genes of interest,

3′UTR is a 3′ untranslated region, and

Poly-A is a 3′ poly-adenylated tail (poly-A tail).

21. The in vitro method of claim 20 , wherein at least one gene of interest (GOI), encodes a therapeutic polypeptide, a prophylactic polypeptide, a diagnostic polypeptide, an antigen, or a non-coding gene that encodes regulatory structures.

22. The in vitro method of claim 20 , wherein at least one GOI encodes a non-coding gene that encodes at least one regulatory structure, wherein the at least one regulatory structure is a small interfering RNA (siRNA), a micro-RNA (miRNA), a guide RNA (gRNA), a self-activating RNA (saRNA), a transfer RNA (tRNA), or a long intergenic non-coding (lincRNA).

23. The in vitro method of claim 17 , wherein at least one GOI encodes an infectious disease antigen, an allergic antigen, or a tumor antigen.

24. The in vitro method of claim 20 , wherein the plurality of non-structural replicase domain sequences are obtained from the TC-83 strain of Venezuelan Equine Encephalitis virus (VEE).

25. The in vitro method of claim 17 , wherein the nucleic acid sequence comprises from 5′ to 3′:

a) Ori-SM-Pr1-L2-Pr2-5′UTR-nsP-L3-GOI-L4-3′UTR-PolyA;

b) L1-Ori-SM-Pr1-Pr2-5′UTR-nsP-L3-GOI-L4-3′UTR-PolyA

c) L1-Ori-SM-Pr1-L2-Pr2-5′UTR-nsP-GOI-L4-3′UTR-PolyA;

d) L1-Ori-SM-Pr1-L2-Pr2-5′UTR-nsP-L3-GOI-3′UTR-PolyA; or

e) L1-Ori-SM-Pr1-L2-Pr2-5′UTR-nsP-SGP-L3-GOI-L4-3′UTR-PolyA,

wherein

L1 is a first linker,

Ori is an origin of replication sequence,

SM is a selectable marker,

Pr1 is a first promoter sequence,

L2 is a second linker,

Pr2 is a second promoter sequence,

5′UTR is a 5′ untranslated region,

nsP is a plurality of non-structural replicase domain sequences,

L3 is a third linker,

SGP is a subgenomic promoter,

GOI is one or more genes of interest,

L4 is a fourth linker,

3′UTR is a 3′ untranslated region, and

Poly-A is a 3′ poly-adenylated tail (poly-A tail).

26. The in vitro method of claim 25 , wherein each of L1, L2, L3, and L4 is independently selected from a nucleic acid a sequence comprising

(SEQ ID NO: 43)

CGCGTGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGC

CAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTT,

(SEQ ID NO: 44)

CACATTTCCCCGAAAAGTGCCACCTGAGCTC,

(SEQ ID NO: 45)

TTCGAAGGCGCGCCTCTAGAGCCACC, or

(SEQ ID NO: 46)

CATCGATGATATCGCGGCCGCATACAGCAGC, or

wherein L1 comprises SEQ ID NO: 43

(CGCGTGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGG

CCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTT); 

L2 comprises SEQ ID NO: 44

(CACATTTCCCCGAAAAGTGCCACCTGAGCTC); 

L3 comprises SEQ ID NO: 45

(TTCGAAGGCGCGCCTCTAGAGCCACC); and 

L4 comprises SEQ ID NO: 46

(CATCGATGATATCGCGGCCGCATACAGCAGC).

27. The in vitro method of claim 17 , wherein the second promoter comprises an engineered T7 promoter comprising the nucleotide sequence of SEQ ID NO: 47 (TAATACGACTCACTATAGG) operably linked to a 5′ UTR.

28. The in vitro method of claim 27 , wherein the 5′ UTR is 3′ to SEQ ID NO: 47 and wherein the 5′ UTR comprises nucleotide sequence ATAGG.

29. The in vitro method of claim 1 , wherein the 5′ UTR comprises nucleotide sequence ATAGG.

Assignments (1)
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded May 12, 2023
From: LI, YINGZHONG; ZHANG, LIBIN
To: SUNVAX MRNA THERAPEUTICS INC.
Reel/Frame 063622/0781 →
Continuity (3)
Provisional Application 63393688 · Jul 29, 2022
Provisional Application 63341018 · May 12, 2022
Related Publication 20230366001A1 · Nov 16, 2023