Methods and compositions comprising CRISPR-Cpf1 and paired guide CRISPR RNAs for programmable genomic deletions
View Patent ↗Described are methods comprises transducing a mammalian cell with one or more virus vectors. Each vector comprises a nucleic acid sequence encoding a Cpf1 (also known as Cas12a) protein and an optional selectable marker in operative association with an RNA pol II promoter which controls expression thereof, and a CRISPR RNA (crRNA) array comprising at least two spacers in operative association with an RNA pol III promoter. Each spacer encodes an RNA guide which hybridizes to a unique sequence located 3′ from a T-rich protospacer-adjacent motif (PAM) in a genomic region of interest. The method further comprises culturing the transduced cells, thereby providing a plurality of cultured cell cultures, each cell culture comprising said deletion. Additionally, described are compositions used in methods as well as libraries generated by the methods. Such compositions comprise libraries of transduced cell cultures, viral vectors, nucleic acid sequences, CRISPR RNA spacers, and RNA guides, as described herein.
1 . An in vitro method comprising:
(a) transducing a mammalian cell with one or more lentiviral vectors, each vector comprising
(i) a nucleic acid sequence encoding a Cpf1 (Cas12a) protein in operative association with an RNA pol II promoter which controls expression thereof, in a mammalian cell; and
(ii) a flipped CRISPR RNA (crRNA) array comprising at least two spacers,
wherein each spacer encodes an RNA guide, wherein each guide hybridizes to a unique sequence located 3 from a T-rich protospacer-adjacent motif (PAM) in a contiguous region of the genome or a chromosome of a mammalian cell, said array in operative association with an RNA pol III promoter, wherein the RNA pol II promoter and the RNA pol III promoter are independent from each other and are present in opposing orientations with respect to each other; and
(b) culturing said transduced cells, wherein in the cultured cells, the Cpf1 (Cas12a) creates a deletion comprising the chromosome or genome between cleavage sites located downstream of the PAM, thereby providing a plurality of transduced cell cultures, each cell culture comprising said deletion.
2 . The method according to claim 1 , wherein said crRNA array comprises between two to ten said spacers.
3 . The method according to claim 1 , wherein the crRNA array comprises a first spacer, a second spacer, and a direct repeat sequence positioned between and interconnecting the first spacer and the second spacer.
4 . The method according to claim 3 , wherein at least one direct repeat is an engineered optimized repeat.
5 . The method according to claim 4 , wherein the optimized repeat comprises a nucleic acid sequence, TAATTTCTACTAAGTGTAGAT, SEQ ID NO: 7.
6 . The method according to claim 4 , wherein the optimized repeat consists of a nucleic acid sequence, TAATTTCTACTAAGTGTAGAT, SEQ ID NO: 7.
7 . The method according to claim 1 , further comprising prior to the transducing step generating a library of CRISPR RNA (crRNA) spacers, wherein each spacer encodes an RNA guide which hybridizes to a unique sequence located 3′ from a T-rich protospacer-adjacent motif (PAM) in a contiguous region of the genome or a chromosome of the mammalian cell, and wherein each crRNA guide hybridizes to a protospacer that is unique as compared to that of any other crRNA in the library.
8 . The method according to claim 1 , further comprising harvesting genomic DNA from each cell culture to identify or quantify the deletion.
9 . The method according to claim 1 , wherein the Cpf1 (Cas12a) cleavage sites for any two crRNA spacers are spaced apart in contiguous sequence of the genome or chromosome by about 100 bp to about 1 mb.
10 . The method according to claim 1 , wherein the deletion occurs in a non-coding sequence of said genome or chromosome.
11 . The method according to claim 1 , wherein the deletion occurs in a coding sequence of said genome or chromosome.
12 . The method according to claim 1 , wherein the culturing step occurs for between more than two and less than 30 days.
13 . The method according to claim 1 , further comprising identifying or quantifying the effects of said deletion on the cell.
14 . The method according to claim 1 , further comprising identifying or quantifying a phenotypic change of the transfected cell cultures.
15 . The method according to claim 1 , further comprising identifying or quantifying response of the transfected cell cultures to a treatment.
16 . The method according to claim 15 , wherein the treatment comprises contact of the cultured cells to a chemical or biological agent or compound, or exposure to a physical treatment.
17 . The method according to claim 16 , wherein said treatment comprises contact of the cells with the chemical compound, and the response is demonstrated as a change in response to the compound in the transduced cultured cells compared to the response exhibited by the cell culture without the deletion.
18 . A library of mammalian cell cultures, wherein each cell of the cell culture comprises at least one deletion in a contiguous DNA of a chromosome or the genome, and wherein the library is generated by the method of claim 1 .
19 . The library according to claim 18 , wherein the cell is an embryonic stem cell or a cancer cell.
20 . The method of claim 1 , wherein the RNA Pol II promoter is EFS and the RNA pol III promoter is hU6.