IP Library › Granted Patent US 12,460,200
Granted Patent B2
US 12,460,200 · App. 16/806,197 · Granted Nov 4, 2025

Methods and compositions comprising CRISPR-Cpf1 and paired guide CRISPR RNAs for programmable genomic deletions

Inventor: Neville Espi Sanjana (New York, NY)
Assignees: NEW YORK GENOME CENTER, INC.; NEW YORK UNIVERSITY
C12N15/1082C12N15/86C12N2310/20C12N2750/14141
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 12,460,200
App. No.
16/806,197
Granted
Nov 4, 2025
Kind
B2
Abstract

Described are methods comprises transducing a mammalian cell with one or more virus vectors. Each vector comprises a nucleic acid sequence encoding a Cpf1 (also known as Cas12a) protein and an optional selectable marker in operative association with an RNA pol II promoter which controls expression thereof, and a CRISPR RNA (crRNA) array comprising at least two spacers in operative association with an RNA pol III promoter. Each spacer encodes an RNA guide which hybridizes to a unique sequence located 3′ from a T-rich protospacer-adjacent motif (PAM) in a genomic region of interest. The method further comprises culturing the transduced cells, thereby providing a plurality of cultured cell cultures, each cell culture comprising said deletion. Additionally, described are compositions used in methods as well as libraries generated by the methods. Such compositions comprise libraries of transduced cell cultures, viral vectors, nucleic acid sequences, CRISPR RNA spacers, and RNA guides, as described herein.

Claims (25)

1 . An in vitro method comprising:

(a) transducing a mammalian cell with one or more lentiviral vectors, each vector comprising

(i) a nucleic acid sequence encoding a Cpf1 (Cas12a) protein in operative association with an RNA pol II promoter which controls expression thereof, in a mammalian cell; and

(ii) a flipped CRISPR RNA (crRNA) array comprising at least two spacers,

wherein each spacer encodes an RNA guide, wherein each guide hybridizes to a unique sequence located 3 from a T-rich protospacer-adjacent motif (PAM) in a contiguous region of the genome or a chromosome of a mammalian cell, said array in operative association with an RNA pol III promoter, wherein the RNA pol II promoter and the RNA pol III promoter are independent from each other and are present in opposing orientations with respect to each other; and

(b) culturing said transduced cells, wherein in the cultured cells, the Cpf1 (Cas12a) creates a deletion comprising the chromosome or genome between cleavage sites located downstream of the PAM, thereby providing a plurality of transduced cell cultures, each cell culture comprising said deletion.

2 . The method according to claim 1 , wherein said crRNA array comprises between two to ten said spacers.

3 . The method according to claim 1 , wherein the crRNA array comprises a first spacer, a second spacer, and a direct repeat sequence positioned between and interconnecting the first spacer and the second spacer.

4 . The method according to claim 3 , wherein at least one direct repeat is an engineered optimized repeat.

5 . The method according to claim 4 , wherein the optimized repeat comprises a nucleic acid sequence, TAATTTCTACTAAGTGTAGAT, SEQ ID NO: 7.

6 . The method according to claim 4 , wherein the optimized repeat consists of a nucleic acid sequence, TAATTTCTACTAAGTGTAGAT, SEQ ID NO: 7.

7 . The method according to claim 1 , further comprising prior to the transducing step generating a library of CRISPR RNA (crRNA) spacers, wherein each spacer encodes an RNA guide which hybridizes to a unique sequence located 3′ from a T-rich protospacer-adjacent motif (PAM) in a contiguous region of the genome or a chromosome of the mammalian cell, and wherein each crRNA guide hybridizes to a protospacer that is unique as compared to that of any other crRNA in the library.

8 . The method according to claim 1 , further comprising harvesting genomic DNA from each cell culture to identify or quantify the deletion.

9 . The method according to claim 1 , wherein the Cpf1 (Cas12a) cleavage sites for any two crRNA spacers are spaced apart in contiguous sequence of the genome or chromosome by about 100 bp to about 1 mb.

10 . The method according to claim 1 , wherein the deletion occurs in a non-coding sequence of said genome or chromosome.

11 . The method according to claim 1 , wherein the deletion occurs in a coding sequence of said genome or chromosome.

12 . The method according to claim 1 , wherein the culturing step occurs for between more than two and less than 30 days.

13 . The method according to claim 1 , further comprising identifying or quantifying the effects of said deletion on the cell.

14 . The method according to claim 1 , further comprising identifying or quantifying a phenotypic change of the transfected cell cultures.

15 . The method according to claim 1 , further comprising identifying or quantifying response of the transfected cell cultures to a treatment.

16 . The method according to claim 15 , wherein the treatment comprises contact of the cultured cells to a chemical or biological agent or compound, or exposure to a physical treatment.

17 . The method according to claim 16 , wherein said treatment comprises contact of the cells with the chemical compound, and the response is demonstrated as a change in response to the compound in the transduced cultured cells compared to the response exhibited by the cell culture without the deletion.

18 . A library of mammalian cell cultures, wherein each cell of the cell culture comprises at least one deletion in a contiguous DNA of a chromosome or the genome, and wherein the library is generated by the method of claim 1 .

19 . The library according to claim 18 , wherein the cell is an embryonic stem cell or a cancer cell.

20 . The method of claim 1 , wherein the RNA Pol II promoter is EFS and the RNA pol III promoter is hU6.

Assignments (2)
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Dec 22, 2025
From: SANJANA, NEVILLE ESPI
To: NEW YORK GENOME CENTER, INC.; NEW YORK UNIVERSITY
Reel/Frame 073295/0078 →
CONFIRMATORY LICENSE Recorded Oct 2, 2023
From: NEW YORK GENOME CENTER
To: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT
Reel/Frame 065091/0174 →
Continuity (3)
Continuation PCTUS2018048767 · Aug 30, 2018
Provisional Application 62552816 · Aug 31, 2017
Related Publication 20200208141A1 · Jul 2, 2020
References Cited (45)
US 5902880A · Thompson · 1999 [cited by applicant]
US 7195916B2 · Qin et al. · 2007 [cited by applicant]
US 9650617B2 · May et al. · 2017 [cited by applicant]
US 20160074535A1 · Ranganathan · 2016 [cited by examiner]
US 20160208243A1 · Zhang · 2016 [cited by examiner]
EP 3009511B1 · 2016 [cited by applicant]
GB 2211504A · 1989 [cited by applicant]
WO WO9609378A1 · 1996 [cited by applicant]
WO WO2014015134A1 · 2014 [cited by applicant]
WO WO2016054153A1 · 2016 [cited by applicant]
WO WO2017066588A2 · 2017 [cited by applicant]
WO WO2017127807A1 · 2017 [cited by applicant]
Jo et al. 2015 Efficient Mitochondrial Genome Editing by CRISPR/Cas9 BioMed Research International vol. 2015, Article ID 305716, 10 pages (Year: 2015). [cited by examiner]
Makarova, et al., “An updated evolutionary classification of CRISPR-Cas systems,” Nature Reviews—Microbiology, Sep. 28, 2015, vol. 13 (pp. 722-736). [cited by applicant]
Schunder et al., “First indication for a functional CRISPR/Cas system in Francisella tularensis, ”International Journal of Medical Microbiology, Mar. 1, 2013, vol. 303 (pp. 51-60). [cited by applicant]
Shmakov et al., “Discovery and Functional Characterization of Diverse Class 2 CRISPR-Cas Systems”, Molecular Cell, Nov. 1, 2015, vol. 60, No. 3 (pp. 385-397). [cited by applicant]
Vestergaard et al., “CRISPR adaptive immune systems of Archaea,” RNA Biology, Feb. 14, 2014, vol. 11, No. 2 (pp. 156-167). [cited by applicant]
Zetsche et al., “Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system,” Cell, Oct. 22, 2015, vol. 163 (pp. 759-771). [cited by applicant]
Brake et al., “Lentiviral Vector Design for Multiple shRNA Expression and Durable HIV-I Inhibition” Molecular Therapy, Mar. 2008, vol. 16, No. 3 (pp. 557-564). [cited by applicant]
Canver et al., “Characterization of genomic deletion efficiency mediated by clustered regularly interspaced palindromic repeats (CRISPR)/Cas9 nuclease system in mammalian cells,” Journal of Biological Chemistry, Aug. 1,… [cited by applicant]
Diao et al., “A tiling1deletion based genetic screen for cis-regulatory element identification in mammalian cells,” Nature Methods, Jun. 2017, vol. 14, No. 6 (pp. 629-635). [cited by applicant]
Doench et al., “Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9”, Nature Biotechnology, Feb. 2016, vol. 34, No. 2 (pp. 184-191). [cited by applicant]
Fonfara et al., “The CRISPR-associated DNA-cleaving enzyme Cpf1 also processes precursor CRISPR RNA,” Nature, 2016, vol. 532 (pp. 517-521). [cited by applicant]
Goeddel ed., “Gene expression technology,” Table of Contents for Methods in Enzymology, vol. 185, Academic Press, 1990 (7 pages). [cited by applicant]
Gong et al., “A gene expression atlas of the central nervous system based on bacterial artificial chromosomes,” Nature, 2003, vol. 425 (pp. 917-925). [cited by applicant]
Hsu et al., “DNA targeting specificity of RNA-guided Cas9 nucleases”, Nature Biotechnology, Sep. 2013, vol. 31, No. 9 (pp. 827-832). [cited by applicant]
Kadonaga, “Perspectives on the RNA polymerase II core promoter,” Wiley Interdisciplinary Review, Developmental Biology, Jan. 2012, vol. 1, No. 1 (pp. 40-51). [cited by applicant]
Kim et al., “Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells,” Nature Biotechnology, Jun. 6, 2016, vol. 34, No. 8, (corrected Jul. 18, 2016)(pp. 863-888). [cited by applicant]
Kim et al., “In vivo high-throughput profiling of CRISPR-Cpf1 activity,” Manuscript Version, Nature Methods, Dec. 2016, vol. 14, No. 2 (23 pages). [cited by applicant]
Kleinstiver et al., “Genome-wide specificities of CRISPR-Cas Cpf1 nucleases in human cells,” Nature Biotechnology, Aug. 2016, vol. 34, No. 8 (pp. 869-874). [cited by applicant]
Kumar et al., “Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm,” Nature Protocols, 2009, vol. 4, No. 8 (pp. 1073-1082). [cited by applicant]
Ma et al., “Quantitative analysis of copy number variants based on real-time Light Cycler PCR,” Current Protocols in Human Genetics, Jan. 21, 2015, vol. 80 (10 pages). [cited by applicant]
Ng et al., “Accounting for Human Polymorphisms Predicted to Affect Protein Function,” Genome Research, 2002, vol. 12, No. 3 (pp. 436-446). [cited by applicant]
Ng et al., “Predicting the Effects of Amino Acid Substitutions on Protein Function,” Annual Review of Genomics and Human Genetics, Sep. 22, 2006, vol. 7 (pp. 61-80). [cited by applicant]
Ng et al., “SIFT: predicting amino acid changes that affect protein function,” Nucleic Acids Research, 2003, vol. 31, No. 13 (pp. 3812-3814). [cited by applicant]
Pulido-Quetglas et al., “Scalable Design of Paired CRISPR Guide RNAs for Genomic Deletion,” PLOS, Computational Biology, Mar. 2, 2017, vol. 13, No. 3 (18 pages). [cited by applicant]
Sanjana et al., “Improved vectors and genome-wide libraries for CRISPR screening,” HHS Public Access Author Manuscript, 2014, vol. 11 (pp. 2145-2148). [cited by applicant]
Sim et al., “SIFT web server: predicting effects of amino acid substitutions on proteins,” Nucleic Acids Research, 2012, vol. 40, Web Server issue (pp. W452-W457). [cited by applicant]
Thompson et al., “A comprehensive comparison of multiple sequence alignment programs,” Nucleic Acids Research, Jul. 1, 1999, vol. 27, No. 13 (pp. 2682-2690). [cited by applicant]
Yacoub et al., “Optimized production and concentration of lentiviral vectors containing large inserts,” The Journal of Gene Medicine, 2007, vol. 9 (pp. 579-584). [cited by applicant]
Yamano et al., “Crystal Structure of Cpf1 in Complex with Guide RNA and Target DNA,” Cell, vol. 165, May 5, 2016 (pp. 949-962), including p. S1-S7 of Supplemental Figures, and pp. 1-2 of Supplemental Information. [cited by applicant]
Young et al., “A Single CRISPR-Cas9 Deletion Strategy that Targets the Majority of DMD Patients Restores Dystrophin Function in hiPSC Derived Muscle Cells,” Cell Stem Cell, Apr. 7, 2016, vol. 18, No. 4 (pp. 533-540). [cited by applicant]
Zetsche et al., “A Survey of Genome Editing Activity for 16 Cpf1 orthologs,” BioRxiv Preprint, this version posted May 4, 2017 (16 pages). [cited by applicant]
Zetsche et al., “Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array,” Nature Biotechnology, Jan. 2017, vol. 35, No. 1 (pp. 31-34). [cited by applicant]
Zhu, S. et al., “Genome-scale deletion screening of human long non-coding RNAs using a paired-guide RNA CRISPR-Cas9 library,” Nature Biotechnology, Oct. 31, 2016, vol. 34, No. 12 (pp. 1279-1286). [cited by applicant]