miRNAS for reducing ventricle enlargement
View Patent ↗The invention is directed to methods and compositions for treating a disease associated with ventricular enlargement such as 22q11 deletion syndrome (22q11 DS) and schizophrenia (SCZ) by replenishment of decreased levels of miR-382-3p and/or miR-674-3p or inhibition of dopamine receptor Drd1 in ependymal cells.
1 . A method for decreasing ventricular enlargement in a subject in need thereof, said method comprising administering to the subject a therapeutically effective amount of (i) miR-382-3p and/or miR-674-3p, or (ii) a vector expressing miR-382-3p and/or miR-674-3p.
2 . The method of claim 1 , wherein the ventricular enlargement is associated with a schizophrenia (SCZ), 22q11 deletion syndrome (22q11DS), Alzheimer's disease, Parkinson's disease, vascular dementia, age-dependent ventriculomegaly, spontaneous ventriculomegaly, hydrocephalus, primary ciliary dyskinesia, or normal aging.
3 . The method of claim 1 , wherein miR-382-3p comprises the sequence AAUCAUUCACGGACAACACUU (SEQ ID NO: 1) or UCAUUCACGGACAACACUUUUU (SEQ ID NO: 2).
4 . The method of claim 3 , wherein miR-382-3p consists of the sequence AAUCAUUCACGGACAACACUU (SEQ ID NO: 1) or UCAUUCACGGACAACACUUUUU (SEQ ID NO: 2).
5 . The method of claim 1 , wherein the miR-674-3p comprises the sequence CACAGCUCCCAUCUCAGAACAA (SEQ ID NO: 3).
6 . The method of claim 5 , wherein miR-674-3p consists of the sequence CACAGCUCCCAUCUCAGAACAA (SEQ ID NO: 3).
7 . The method of claim 1 , wherein the administration is inside the ventricles of the subject.
8 . The method of claim 7 , wherein the administration is by intracerebroventricular injection.
9 . The method of claim 1 , wherein the administration results in a decrease in ventricular enlargement, an increase in ciliary beating on ependymal cells lining the walls of lateral ventricles (LVs) of the subject, a decrease of dopamine receptor (Drd1) expression and/or function in ependymal cells lining the walls of ventricles of the subject, and/or an increase in the level of miR-382-3p and/or miR-674-3p in ependymal cells lining the walls of ventricles of the subject.
10 . The method of claim 9 , wherein the administration results in a decrease in ventricular enlargement of one or more of the brain lateral ventricles (LVs) and/or third ventricle (TV) of the subject.
11 . The method of claim 1 , wherein the subject has an increased size of one or more brain ventricles, a decreased ciliary beating on ependymal cells lining the walls of lateral ventricles (LVs), an increased dopamine receptor (Drd1) expression and/or function in ependymal cells lining the walls of ventricles, and/or a decreased level of miR-382-3p and/or miR-674-3p in ependymal cells lining the walls of ventricles as compared to a control.
12 . The method of claim 11 , wherein the brain ventricles are lateral ventricles (LVs) and/or third ventricle (TV).
13 . The method of claim 11 , wherein the control is a predetermined standard, or the value in a healthy age- and gender-matched subject, or an average value for several such subjects.
14 . The method of claim 1 , wherein the vector is selected from adeno-associated virus (AAV) vectors, lentivirus vectors, adenoviral vector, retroviral vectors, alphaviral vectors, vaccinia virus vectors, herpes simplex virus (HSV) vectors, rabies virus vectors, and Sindbis virus vectors.
15 . The method of claim 1 , further comprising administering to the subject an additional treatment agent.
16 . The method of claim 15 , wherein the additional treatment agent is an antipsychotic.
17 . The method of claim 1 , wherein the ventricular enlargement is caused by decreased ciliary beating on ependymal cells.