Selective recovery
Provided herein are methods of selective screening. In addition, various targeting proteins and sequences, as well as methods of their use, are also provided.
1. An AAV polynucleotide comprising a capsid sequence, wherein said capsid sequence (a) encodes an AAV capsid protein, (b) has at least 99% identity to SEQ ID NO: 11, and (c) comprises a nucleotide sequence which comprises at least 12 nucleotides from the sequence ACTTTGGCGGTGCCTTTTAAG (SEQ ID NO: 24) and which encodes at least 4 contiguous amino acids from the sequence TLAVPFK (SEQ ID NO: 1).
2. The AAV polynucleotide of claim 1 , wherein the capsid sequence comprises ACTTTGGCGGTGCCTTTTAAG (SEQ ID NO: 24).
3. The AAV polynucleotide of claim 1 , wherein the capsid sequence comprises ACTTTGGCGGTGCCTTTTAAG (SEQ ID NO: 24) inserted between two nucleotides in the capsid sequence which correspond to nucleotides 1764 and 1765 of SEQ ID NO: 11.
4. The AAV polynucleotide of claim 1 , wherein the capsid sequence comprises SEQ ID NO: 9.
5. An AAV capsid protein encoded by an AAV polynucleotide comprising a capsid sequence, wherein said capsid sequence (a) encodes said AAV capsid protein, (b) has at least 99% identity to SEQ ID NO: 11, and (c) comprises a nucleotide sequence which comprises at least 12 nucleotides from the sequence ACTTTGGCGGTGCCTTTTAAG (SEQ ID NO: 24) and which encodes at least 4 contiguous amino acids from the sequence TLAVPFK (SEQ ID NO: 1).
6. The AAV capsid protein of claim 5 , wherein the AAV capsid protein comprises a capsid amino acid sequence having at least 99% identity to SEQ ID NO: 2.
7. The AAV capsid protein of claim 6 , wherein the capsid amino acid sequence comprises TLAVPFK (SEQ ID NO: 1).
8. The AAV capsid protein of claim 6 , wherein the capsid amino acid sequence comprises TLAVPFK (SEQ ID NO: 1) inserted between two amino acids in the capsid amino acid sequence which correspond to amino acids 588-589 of SEQ ID NO: 2.
9. The AAV capsid protein of claim 6 , wherein the capsid amino acid sequence comprises SEQ ID NO: 8.