Compositions related to rna in circularized form
The present invention provides circularized RNA and methods of making and using the same.
1. A nucleic acid in the 5′ to 3′ direction comprising:
a 5′ motif comprising 5 to 50 random nucleotides;
a 5′ complement-reverse complement (CRC) sequence comprising 10 to 50 nucleotides;
an RNA sequence of at least 300 nucleotides;
a 3′ CRC sequence comprising 10 to 50 nucleotides; and
a 3′ motif comprising 5 to 50 random nucleotides,
wherein the 5′ motif is not complementary to the 3′ motif, and
wherein the 5′ CRC sequence is fully complementary to the 3′ CRC sequence.
2. The nucleic acid of claim 1 , wherein the RNA sequence is capable of being translated into a polypeptide.
3. The nucleic acid of claim 1 , wherein the RNA sequence comprises a RNA that is a reverse complement of an endogenous RNA.
4. The nucleic acid of claim 3 , wherein the endogenous RNA is an mRNA.
5. The nucleic acid of claim 1 , wherein RNA sequence is capable of binding to an RNA-binding protein (RBP).
6. The nucleic acid of claim 1 , wherein the 5′ motif comprises 10, 15, or 20 random nucleotides and/or the 3′ motif comprises 10, 15, or 20 random nucleotides.
7. The nucleic acid of claim 1 , wherein the 5′ motif and the 3′ motif are partially complementary.
8. The nucleic acid of claim 1 , wherein at least one of the 5′ motif and the 3′ motif comprises a polyA sequence.
9. The nucleic acid of claim 8 , wherein the polyA sequence comprises 5 to 20 nucleotides.
10. The nucleic acid of claim 1 , wherein the 5′ CRC sequence comprises 10, 20, 30, or 40 nucleotides and/or the 3′ CRC sequence comprises 10, 20, 30, or 40 nucleotides.
11. The nucleic acid of claim 10 , wherein the 5′ CRC sequence comprises 20 nucleotides and/or the 3′ CRC sequence comprises 20 nucleotides.
12. The nucleic acid of claim 11 , wherein the 5′ CRC sequence comprises tggctgcacgaattgcacaa (SEQ ID NO: 1) and the 3′ CRC sequence comprises ttgtgcaattcgtgcagcca (SEQ ID NO: 2).
13. The nucleic acid of claim 2 , wherein the polypeptide encodes a therapeutic protein.
14. The nucleic acid of claim 13 , wherein the therapeutic protein is preproinsulin, hypocretin, human growth hormone, leptin, oxytocin, vasopressin, factor VII, factor VIII, factor IX, erythropoietin, G-CSF, alpha-galactosidase A, iduronidase, N-acetylgalactosamine-4-sulfatase, FSH, DNase, tissue plasminogen activator, glucocerebrosidase, interferon, or IGF-1.
15. The nucleic acid of claim 1 , wherein the nucleic acid comprises a modified nucleotide.
16. The nucleic acid of claim 15 , wherein the modified nucleotide is a nucleotide analog selected from the group consisting of 5-propynyluridine, 5-propynylcytidine, 6-methyladenine, 6-methylguanine, N,N,-dimethyladenine, 2-propyladenine, 2-propylguanine, 2-aminoadenine, 1-methylinosine, 3-methyluridine, 5-methylcytidine, 5-methyluridine, 5-(2-amino)propyl uridine, 5-halocytidine, 5-halouridine, 4-acetylcytidine, 1-methyladenosine, 2-methyladenosine, 3-methylcytidine, 6-methyluridine, 2-methylguanosine, 7-methylguanosine, 2,2-dimethylguanosine, 5-methylaminoethyluridine, 5-methyloxyuridine, 7-deaza-adenosine, 6-azouridine, 6-azocytidine, 6-azothymidine, 5-methyl-2-thiouridine, 2-thiouridine, 4-thiouridine, 2-thiocytidine, dihydrouridine, pseudouridine, queuosine, archaeosine, naphthyl substituted naphthyl groups, an O- and N-alkylated purines and pyrimidines, N6-methyladenosine, 5-methylcarbonylmethyluridine, uridine 5-oxyacetic acid, pyridine-4-one, pyridine-2-one, aminophenol, 2,4,6-trimethoxy benzene, modified cytosines that act as G-clamp nucleotides, 8-substituted adenines and guanines, 5-substituted uracils and thymines, azapyrimidines, carboxyhydroxyalkyl nucleotides, carboxyalkylaminoalkyl nucleotides, and alkylcarbonylalkylated nucleotides.
17. The nucleic acid of claim 16 , wherein the modified nucleotide is 5-methylcytidine (5mC).
18. The nucleic acid of claim 1 , wherein the nucleic acid's 5′ and 3′ termini are ligated such that the nucleic acid is circularized.
19. The nucleic acid of claim 18 , wherein the circularized nucleic acid has greater stability relative to a non-circularized nucleic acid.
20. The nucleic acid of claim 19 , wherein the greater stability is in vitro or in vivo.
21. The nucleic acid of claim 18 , wherein the circularized nucleic acid provides greater polypeptide translation relative to a non-circularized nucleic acid.
22. The nucleic acid of claim 21 , wherein the greater polypeptide translation is in vitro or in vivo.
23. An isolated cell comprising the nucleic acid of claim 18 .
24. The nucleic acid of claim 1 , further comprising at least one of a 5′ UTR and a 3′ UTR, wherein the 5′ UTR is located between the 5′ CRC sequence and the RNA sequence and the 3′ UTR is located between the RNA sequence and the 3′ CRC sequence.
25. The nucleic acid of claim 24 , wherein the 5′ UTR is polyAx30, polyAx120, PPT19, PPT19x4, GAAAx7, or polyAx30-EMCV.
26. The nucleic acid of claim 24 , wherein the 3′ UTR is HbB1-PolyAx10, HbB1, HbB1x2, or a motif from the Elastin 3′ UTR.
27. The nucleic acid of claim 26 , wherein the Elastin 3′ UTR or a motif thereof is repeated twice or three times.
28. The nucleic acid of claim 25 , wherein the 5′ UTR is PPT19 or repeats thereof and the 3′ UTR is derived from Elastin or a motif thereof and/or repeats thereof.
29. The nucleic acid of claim 24 , wherein the 5′ UTR comprises an internal ribosome entry site (IRES).
30. The nucleic acid of claim 29 , wherein the IRES is an encephalomyocarditis virus (EMCV) IRES or a PPT19 IRES.