IP Library › Granted Patent US 12,319,916
Granted Patent B2
US 12,319,916 · App. 18/752,290 · Granted Jun 3, 2025

Modulation of gene transcription using antisense oligonucleotides targeting regulatory RNAs

Inventors: Alfica Sehgal (Belmont, MA); Bryan J. Matthews (Somerville, MA); David A. Bumcrot (Belmont, MA); Justin A. Caravella (Cambridge, MA); Mario Esteban Contreras Gamboa (Cambridge, MA); Rachana S. Kelkar (Malden, MA); Yun Joon Jung (Lexington, MA); Yuting Liu (Lexington, MA); Rutuja Sudhakar Pai (Charlestown, MA); Subhadeep Roy (Lafayette, CO); Yuchun Guo (Framingham, MA)
Assignee: CAMP4 Therapeutics Corporation
C12N15/1137A61P13/00C12Y603/04016C12N2310/113C12N2310/315C12N2310/3231C12N2310/3341C12N2310/341C12N2310/351C12N2310/3525
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 12,319,916
App. No.
18/752,290
Granted
Jun 3, 2025
Kind
B2
Abstract

Described herein are methods of modulating gene transcription using antisense oligonucleotides (ASOs) targeting regulatory RNAs, such as promoter-associated RNAs and enhancer RNAs. These methods are useful for modulating the levels of gene products, for example, increasing expression of Carbamoyl-Phosphatase Synthetase 1 (CPS1), thereby treating diseases associated with aberrant gene expression.

Claims (15)

1. An antisense oligonucleotide (ASO) comprising a nucleotide sequence of TGCAGGCACACACATCAGGC (SEQ ID NO: 1), wherein one or more of the nucleotides of the ASO are chemically modified.

2. The ASO of claim 1 , wherein the 3′ end of the ASO is conjugated to a ligand moiety.

3. The ASO of claim 2 , wherein the ligand moiety comprises N-acetylgalactosamine (GalNAc).

4. The ASO of claim 3 , wherein the ligand moiety comprises a three-cluster GalNAc moiety (GalNAc3).

5. An antisense oligonucleotide (ASO) comprising MT=MG=M5C-MA-MG=dG=d5C=dA=d5C=dA=d5C-dA=d5C-dA=dT=M5C-MA-MG=MG=M5C-[TEG] (SEQ ID NO: 409), wherein MT, MG, MA, and M5C are 2′-O-methoxyethyl thymidine, 2′-O-methoxyethyl guanosine, 2′-O-methoxyethyl adenosine, and 2′-O-methoxyethyl 5-methyl cytidine ribonucleosides; dA, dG, dT, and d5C are 2′-deoxy adenosine, 2′-deoxy guanosine, 2′-deoxy thymidine and 2′-deoxy 5-methyl cytidine ribonucleosides, “=” is a phosphorothioate linkage, “-” is a phosphodiester linkage, and [TEG] is a ligand moiety comprising a triethyleneglycol linked to N-acetylgalactosamine (GalNAc).

6. The ASO of claim 5 , wherein the ligand moiety comprises a three-cluster GalNAc moiety (GalNAc3).

7. An antisense oligonucleotide (ASO) comprising MT=MG=M5C-MA-MG-dG-d5C=dA=d5C=dA=d5C=dA=d5C=dA=dT=M5C-MA-MG-MG=M5C (SEQ ID NO: 404), wherein MT, MG, MA, and M5C are 2′-O-methoxyethyl thymidine, 2′-O-methoxyethyl guanosine, 2′-O-methoxyethyl adenosine, and 2′-O-methoxyethyl 5-methyl cytidine ribonucleosides; dA, dG, dT, and d5C are 2′-deoxy adenosine, 2′-deoxy guanosine, 2′-deoxy thymidine and 2′-deoxy 5-methyl cytidine ribonucleosides, “=” is a phosphorothioate linkage, and “-” is a phosphodiester linkage.

8. A pharmaceutical composition comprising the ASO of claim 1 .

9. A pharmaceutical composition comprising the ASO of claim 5 .

10. A pharmaceutical composition comprising the ASO of claim 7 .

11. The ASO of claim 7 , wherein the 3′ end of the ASO is conjugated to a ligand moiety.

12. The ASO of claim 11 , wherein the ligand moiety comprises N-acetylgalactosamine (GalNAc).

13. The ASO of claim 12 , wherein the ligand moiety comprises a three-cluster GalNAc moiety (GalNAc3).

14. A pharmaceutical composition comprising the ASO of claim 6 .

15. A pharmaceutical composition comprising the ASO of claim 13 .

Assignments (1)
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Jul 8, 2024
From: SEHGAL, ALFICA; MATTHEWS, BRYAN J.; BUMCROT, DAVID A.; CARAVELLA, JUSTIN A.; GAMBOA, MARIO ESTEBAN CONTRERAS; KELKAR, RACHANA S.; JUNG, YUN JOON; LIU, YUTING; PAI, RUTUJA SUDHAKAR; MOUKHEIBER, HENRY MUNIR; ROY, SUBHADEEP; GUO, YUCHUN
To: CAMP4 THERAPEUTICS CORPORATION
Reel/Frame 067927/0450 →
Continuity (4)
Continuation PCTUS2022082295 · Dec 22, 2022
Provisional Application 63308373 · Feb 9, 2022
Provisional Application 63292920 · Dec 22, 2021
Related Publication 20240336924A1 · Oct 10, 2024
References Cited (370)
US 4683202A · Mullis · 1987 [cited by applicant]
US 4837028A · Allen · 1989 [cited by applicant]
US 4897355A · Eppstein et al. · 1990 [cited by applicant]
US 5171678A · Behr et al. · 1992 [cited by applicant]
US 5283185A · Epand et al. · 1994 [cited by applicant]
US 5445934A · Fodor et al. · 1995 [cited by applicant]
US 5543152A · Webb et al. · 1996 [cited by applicant]
US 5677195A · Winkler et al. · 1997 [cited by applicant]
US 5744305A · Fodor et al. · 1998 [cited by applicant]
US 5770722A · Lockhart et al. · 1998 [cited by applicant]
US 5854033A · Lizardi · 1998 [cited by applicant]
US 5874219A · Rava et al. · 1999 [cited by applicant]
US 5976567A · Wheeler et al. · 1999 [cited by applicant]
US 5981501A · Wheeler et al. · 1999 [cited by applicant]
US 6268490B1 · Imanishi et al. · 2001 [cited by applicant]
US 6525191B1 · Ramasamy · 2003 [cited by applicant]
US 6534484B1 · Wheeler et al. · 2003 [cited by applicant]
US 6586410B1 · Wheeler et al. · 2003 [cited by applicant]
US 6670461B1 · Wengel et al. · 2003 [cited by applicant]
US 6770748B2 · Imanishi et al. · 2004 [cited by applicant]
US 6794499B2 · Wengel et al. · 2004 [cited by applicant]
US 6815432B2 · Wheeler et al. · 2004 [cited by applicant]
US 6998484B2 · Koch et al. · 2006 [cited by applicant]
US 7034133B2 · Wengel et al. · 2006 [cited by applicant]
US 7053207B2 · Wengel · 2006 [cited by applicant]
US 7084125B2 · Wengel · 2006 [cited by applicant]
US 7250496B2 · Bentwich · 2007 [cited by applicant]
US 7399845B2 · Seth et al. · 2008 [cited by applicant]
US 7427605B2 · Davis et al. · 2008 [cited by applicant]
US 7427672B2 · Imanishi et al. · 2008 [cited by applicant]
US 7569686B1 · Bhat et al. · 2009 [cited by applicant]
US 7687616B1 · Bentwich et al. · 2010 [cited by applicant]
US 7741457B2 · Seth et al. · 2010 [cited by applicant]
US 7777022B2 · Bentwich et al. · 2010 [cited by applicant]
US 7834170B2 · Khvorova et al. · 2010 [cited by applicant]
US 7888497B2 · Bentwich et al. · 2011 [cited by applicant]
US 7943754B2 · Bentwich et al. · 2011 [cited by applicant]
US 8022193B2 · Seth et al. · 2011 [cited by applicant]
US 8030467B2 · Seth et al. · 2011 [cited by applicant]
US 8030474B2 · Khvorova et al. · 2011 [cited by applicant]
US 8039608B1 · Bentwich · 2011 [cited by applicant]
US 8084598B1 · Bentwich · 2011 [cited by applicant]
US 8178503B2 · Rigoutsos et al. · 2012 [cited by applicant]
US 8278283B2 · Seth et al. · 2012 [cited by applicant]
US 8278425B2 · Prakash et al. · 2012 [cited by applicant]
US 8278426B2 · Seth et al. · 2012 [cited by applicant]
US 8314227B2 · Wengel · 2012 [cited by applicant]
US 8362230B2 · Plasterk et al. · 2013 [cited by applicant]
US 8445666B2 · Rigoutsos et al. · 2013 [cited by applicant]
US 8494784B2 · Huynh et al. · 2013 [cited by applicant]
US 8691829B2 · Ulrich · 2014 [cited by applicant]
US 9518261B2 · Freier et al. · 2016 [cited by applicant]
US 9527847B2 · Palombella et al. · 2016 [cited by applicant]
US 10059941B2 · Krieg et al. · 2018 [cited by applicant]
US 11266655B2 · Sehgal et al. · 2022 [cited by applicant]
US 20040171570A1 · Allerson et al. · 2004 [cited by applicant]
US 20040265865A1 · Mattick et al. · 2004 [cited by applicant]
US 20050019841A1 · Garman et al. · 2005 [cited by applicant]
US 20060058255A1 · Chen et al. · 2006 [cited by applicant]
US 20070280928A1 · Buck et al. · 2007 [cited by applicant]
US 20080039618A1 · Allerson et al. · 2008 [cited by applicant]
US 20080176786A1 · Ditullio et al. · 2008 [cited by applicant]
US 20090012281A1 · Swayze et al. · 2009 [cited by applicant]
US 20090111132A1 · Poynard · 2009 [cited by applicant]
US 20090258925A1 · Wahlestedt · 2009 [cited by applicant]
US 20100166784A1 · Murphy et al. · 2010 [cited by applicant]
US 20100324120A1 · Chen et al. · 2010 [cited by applicant]
US 20110313020A1 · Templin et al. · 2011 [cited by applicant]
US 20120028838A1 · Cantor et al. · 2012 [cited by applicant]
US 20120157511A1 · Manoharan et al. · 2012 [cited by applicant]
US 20130011922A1 · Quay et al. · 2013 [cited by applicant]
US 20130096289A1 · Wengel · 2013 [cited by applicant]
US 20130190383A1 · Vaish et al. · 2013 [cited by applicant]
US 20130237562A1 · Barda et al. · 2013 [cited by applicant]
US 20130245099A1 · Collard et al. · 2013 [cited by applicant]
US 20130317086A1 · Guire et al. · 2013 [cited by applicant]
US 20140038920A1 · Ballabio et al. · 2014 [cited by applicant]
US 20140135376A1 · Engbersen et al. · 2014 [cited by applicant]
US 20140342003A1 · Saltzman et al. · 2014 [cited by applicant]
US 20150133362A1 · Krieg et al. · 2015 [cited by applicant]
US 20150174549A1 · Lim et al. · 2015 [cited by applicant]
US 20150225717A1 · Lee et al. · 2015 [cited by applicant]
US 20150225719A1 · Chen et al. · 2015 [cited by applicant]
US 20150232858A1 · Ozsolak · 2015 [cited by applicant]
US 20150297598A1 · Friedman et al. · 2015 [cited by applicant]
US 20150307554A1 · Castillo Rodriguez · 2015 [cited by applicant]
US 20150335764A1 · Martinez Fong · 2015 [cited by applicant]
US 20160230189A1 · Kotha et al. · 2016 [cited by applicant]
US 20160251478A1 · Saltzman et al. · 2016 [cited by applicant]
US 20160264966A1 · Fitzgerald et al. · 2016 [cited by applicant]
US 20160271116A1 · Jia et al. · 2016 [cited by applicant]
US 20160279256A1 · Wang et al. · 2016 [cited by applicant]
US 20160312216A1 · Fitzgerald et al. · 2016 [cited by applicant]
US 20160348073A1 · Meissner et al. · 2016 [cited by applicant]
US 20160366813A1 · Haneda et al. · 2016 [cited by applicant]
US 20160369269A1 · Shen et al. · 2016 [cited by applicant]
US 20170121454A1 · Saltzman et al. · 2017 [cited by applicant]
US 20170130247A1 · Dowen et al. · 2017 [cited by applicant]
US 20170143682A1 · Melin · 2017 [cited by applicant]
US 20170175128A1 · Welstead et al. · 2017 [cited by applicant]
US 20170204407A1 · Gilbert et al. · 2017 [cited by applicant]
US 20170296653A1 · Mumm et al. · 2017 [cited by applicant]
US 20170349903A1 · Liu et al. · 2017 [cited by applicant]
US 20180201936A1 · Hinkle · 2018 [cited by applicant]
US 20180273609A1 · Porteus et al. · 2018 [cited by applicant]
US 20180320175A1 · Lee et al. · 2018 [cited by applicant]
US 20190040395A1 · Freier · 2019 [cited by applicant]
US 20190046471A1 · Koeberl et al. · 2019 [cited by applicant]
US 20190048337A1 · Hsu et al. · 2019 [cited by applicant]
US 20190136230A1 · Sather et al. · 2019 [cited by applicant]
US 20190153477A1 · Lundberg et al. · 2019 [cited by applicant]
US 20190270984A1 · Gourguechon · 2019 [cited by applicant]
US 20190309259A1 · Meissner et al. · 2019 [cited by applicant]
US 20190374655A1 · Kabadi et al. · 2019 [cited by applicant]
US 20200095579A1 · Lundberg et al. · 2020 [cited by applicant]
US 20200316038A1 · Sehgal et al. · 2020 [cited by applicant]
US 20210114996A1 · Sehgal et al. · 2021 [cited by applicant]
US 20210130804A1 · Baram et al. · 2021 [cited by applicant]
US 20210161997A1 · Bumcrot et al. · 2021 [cited by applicant]
US 20210180091A1 · Chakraborty et al. · 2021 [cited by applicant]
US 20210254056A1 · Liu et al. · 2021 [cited by applicant]
US 20220090036A1 · Oakes et al. · 2022 [cited by applicant]
US 20220107328A1 · Bumcrot et al. · 2022 [cited by applicant]
US 20220168316A1 · Sehgal et al. · 2022 [cited by applicant]
US 20220340898A1 · Chen et al. · 2022 [cited by applicant]
US 20230042624A1 · Gilbert et al. · 2023 [cited by applicant]
WO WO1988004924A1 · 1988 [cited by applicant]
WO WO1991016024A1 · 1991 [cited by applicant]
WO WO1993024640A2 · 1993 [cited by applicant]
WO WO1994000569A1 · 1994 [cited by applicant]
WO WO1994002595A1 · 1994 [cited by applicant]
WO WO1996037194A1 · 1996 [cited by applicant]
WO WO1996040964A2 · 1996 [cited by applicant]
WO WO1997013499A1 · 1997 [cited by applicant]
WO WO1998039352A1 · 1998 [cited by applicant]
WO WO1998039359A1 · 1998 [cited by applicant]
WO WO1999014226A2 · 1999 [cited by applicant]
WO WO2000003683A2 · 2000 [cited by applicant]
WO WO2000047599A1 · 2000 [cited by applicant]
WO WO2000066604A2 · 2000 [cited by applicant]
WO WO2001044465A2 · 2001 [cited by applicant]
WO WO2004046160A2 · 2004 [cited by applicant]
WO WO2007090071A2 · 2007 [cited by applicant]
WO WO2007134181A2 · 2007 [cited by applicant]
WO WO2008042973A2 · 2008 [cited by applicant]
WO WO2008046510A1 · 2008 [cited by applicant]
WO WO2008150729A2 · 2008 [cited by applicant]
WO WO2008154401A2 · 2008 [cited by applicant]
WO WO2009006478A2 · 2009 [cited by applicant]
WO WO2009067647A1 · 2009 [cited by applicant]
WO WO2009088891A1 · 2009 [cited by applicant]
WO WO2009132131A1 · 2009 [cited by applicant]
WO WO2009143371A2 · 2009 [cited by applicant]
WO WO2010036698A1 · 2010 [cited by applicant]
WO WO2010077578A1 · 2010 [cited by applicant]
WO WO2011005861A1 · 2011 [cited by applicant]
WO WO2011017521A2 · 2011 [cited by applicant]
WO WO2011081942A1 · 2011 [cited by applicant]
WO WO2011156202A1 · 2011 [cited by applicant]
WO WO2012170930A1 · 2012 [cited by applicant]
WO WO2013036868A1 · 2013 [cited by applicant]
WO WO2013149141A1 · 2013 [cited by applicant]
WO WO2013154798A1 · 2013 [cited by applicant]
WO WO2013173608A1 · 2013 [cited by applicant]
WO WO2013177248A2 · 2013 [cited by applicant]
WO WO2014066848A1 · 2014 [cited by applicant]
WO WO2014152211A1 · 2014 [cited by applicant]
WO WO2014161046A1 · 2014 [cited by applicant]
WO WO2016118697A1 · 2016 [cited by applicant]
WO WO2016130806A2 · 2016 [cited by applicant]
WO WO2016191427A1 · 2016 [cited by applicant]
WO WO2016207647A1 · 2016 [cited by applicant]
WO WO2017011710A2 · 2017 [cited by applicant]
WO WO2017031370A1 · 2017 [cited by applicant]
WO WO2017049157A1 · 2017 [cited by applicant]
WO WO2017049386A1 · 2017 [cited by applicant]
WO WO2017075406A1 · 2017 [cited by applicant]
WO WO2017106345A1 · 2017 [cited by applicant]
WO WO2017139212A1 · 2017 [cited by applicant]
WO WO2017158358A1 · 2017 [cited by applicant]
WO WO2017201342A1 · 2017 [cited by applicant]
WO WO2018204764A1 · 2018 [cited by applicant]
WO WO2019040471A1 · 2019 [cited by applicant]
WO WO2019071276A1 · 2019 [cited by applicant]
WO WO2020191153A2 · 2020 [cited by applicant]
WO WO2020191171A1 · 2020 [cited by applicant]
WO WO2020210642A1 · 2020 [cited by applicant]
WO WO2022115539A2 · 2022 [cited by applicant]
WO WO2022236147A1 · 2022 [cited by applicant]
WO WO2022256448A2 · 2022 [cited by applicant]
WO WO2023034983A2 · 2023 [cited by applicant]
WO WO2023089153A1 · 2023 [cited by applicant]
WO WO2023102188A1 · 2023 [cited by applicant]
WO WO2023212584A2 · 2023 [cited by applicant]
Adam et al. (2019) “Overexpression of carbamoyl-phosphate synthase 1 significantly improves ureagenesis of human liver HepaRG cells only when cultured under shaking conditions,” Mitochondrion 47:298-308. [cited by applicant]
Ah Mew et al. (2017) “Urea Cycle Disorders Overview,” https://www.ncbi.nlm.nih.gov/books/ 20 pages. [cited by applicant]
Ai et al. (2012) “Regulation of hepatic LDL receptors by mTORC1 and PCSK9 in mice.” [cited by applicant]
Aigner (2006) “Delivery Systems for the Direct Application of siRNAs to Induce RNA Interference (RNAi) In Vivo,” Journal of Biomedicine and Biotechnology 2006:1-15. [cited by applicant]
Akhtar et al. (1992) “Cellular uptake and intracellular fate of antisense oligonucleotides,” Trends in Cell Biology 2:139-144. [cited by applicant]
Akinc et al. (2008) “A combinatorial library of lipid-like materials for delivery of RNAi therapeutics,” Nature Biotechnology 26(5):561-569. [cited by applicant]
Allegri et al. (2018) “Comprehensive characterization of ureagenesis in the spfash mouse, a modfel of human ornithine transcarbamylase deficiency, reveals age-dependency of ammonia detoxification,” [cited by applicant]
Allen et al. (1987) “Large unilamellar liposomes with low uptake into the reticuloendothelial system,” FEBS Letters 223(1):42-46. [cited by applicant]
Arnold et al. (2007) “Specific β1-adrenergic receptor silencing with small interfering RNA lowers high blood pressure and improves cardiac function in myocardial ischemia,” Journal of Hypertension 25(1):197-205. [cited by applicant]
Baclig et al. (2014) “Genetic variation I148M in patatin-like phospholipase 3 gene and risk of non-alcoholic fatty liver disease among Filipinos.” International journal of clinical and experimental medicine 7(8):2129-21… [cited by applicant]
Bangham et al. (1965) “Diffusion of Univalent lons across the Lamellae of Swollen Phospholipids,” J. Mol. Biol. 13:238-252. [cited by applicant]
Barany (1991) “Genetic disease detection and DNA amplification using cloned thermostable ligase,” Pro. Natl. Acad. Sci. USA 88:189-193. [cited by applicant]
Barba et al. (2019) “Lipid Delivery Systems for Nucleic-Acid-Based-Drugs: From Production to Clinical Applications,” Pharmaceutics 11, 360 26 pages. [cited by applicant]
Barbieri et al. (2016) “Proteogenomics: key driver for clinical discovery and personalized medicine.” Proteogenomics, pp. 21-47. [cited by applicant]
BasuRay et al. (2017) “The PNPLA3 Variant Associated With Fatty Liver Disease (I148M) Accumulates on Lipid Droplets by Evading Ubiquitylation,” Hepatology66(4):1111-1124. [cited by applicant]
Bhattacharjee et al. (2013) “Inhibition of Vascular Permeability by Antisense-Mediated Inhibition of Plasma Kallikrein and Coagulation Factor 12,” Nucleic Acid Therapeutics 23(3):175-187. [cited by applicant]
Bonnet et al. (2008) “Systemic Delivery of DNA or siRNA Mediated by Linear Polyethylenimine (L-PEI) Does Not Induce an Inflammatory Response,” Pharmaceutical Research 11 pages. [cited by applicant]
Briand et al. (1982) “Ornithine Transcarbamylase Deficiencies in Human Males. Kinetic and Immunochemical Classification,” Biochim. Biophys. Acta 704(1):100-6. [cited by applicant]
Bruschi et al. (2017) “The PNPLA3 I148M Variant Modulates the Fibrogenic Phenotype of Human Hepatic Stellate Cells,” Hepatology 65(6):1875-1890. [cited by applicant]
Bumcrot et al. (May 11, 2022) “Therapeutics Upregulation of Gene Expression by Antisense Oligonucleotide Targeting of Regulatory RNAs” [Conference presentation]. TIDES USA: Oligonucleotide & Peptide Therapeutics, Boston… [cited by applicant]
Çeliktas et al. (2017) “Role of CPS1 in cell growth, metabolism, and prognosis in LKB1-inactivated lung adenocarcinoma,” JNCI: Journal of the National Cancer Institute 109(3):9 pages. [cited by applicant]
Chen et al. (2015) “PNPLA3 I148M variant in nonalcoholic fatty liver disease: Demographic and ethnic characteristics and the role of the variant in nonalcoholic fatty liver fibrosis,” World J Gastroenterol 21(3):794-802. [cited by applicant]
Chiang et al. (2007) “Dysregulation of C/EBPa by mutant Huntingtin causes the urea cycle deficiency in Huntington's disease.” Human molecular genetics 16(5):483-498. [cited by applicant]
Chien et al. (2005) “Novel cationic cardiolipin analogue-based liposome for efficient DNA and small interfering RNA delivery in vitro and in vivo,” Cancer Gene Therapy 12:321-328. [cited by applicant]
Conway et al. (2017) “A mouse model of hereditary coproporphyria identified in an ENU mutagenesis screen.” [cited by applicant]
Corces et al. (2017) “An improved ATAC-seq protocol reduces background and enables interrogation of frozen tissues,” Nat Methods 14(10):959-962 (15 pages). [cited by applicant]
Cui et al. (2021) “Liver-Targeted Delivery of Oligonucleotides with N-Acetylgalactosamine Conjugation,” ACS Omega 6:16259-16265. [cited by applicant]
Debacker et al. (2020) “Delivery of Oligonucleotides to the Liver Therapeutic Drug,” Molecular Therapy 28(8):1759-1771. [cited by applicant]
Deleavey et al. (2012) “Designing Chemically Modified Oligonucleotides for Targeted Gene Silencing,” Chemistry & Bilology 19:937-954. [cited by applicant]
Derwall et al. (2012) “Inhibition of bone morphogenetic protein signaling reduces vascular calcification and atherosclerosis,” [cited by applicant]
Dowen et al. (2014) “Control of cell identity genes occurs in insulated neighborhoods in mammalian chromosomes,” Cell 159(2):374-387. [cited by applicant]
Du Plessis et al. (1992) “Topical delivery of liposomally encapsulated gamma-interferon,” Antiviral Research 18:259-265. [cited by applicant]
Durymanov et al. (2018) “Non-viral Delivery of Nucleic Acids: Insight Into Mechanisms of Overcoming Intracellular Barriers,” frontiers in Pharmacology 9, Article 971, 15 pages. [cited by applicant]
El Khoury et al. (2017) “PCSK9 mutations in familial hypercholesterolemia: from a groundbreaking discovery to anti-PCSK9 therapies,” [cited by applicant]
Felgner et al. (1987) “Lipofection: A highly efficient, lipid-mediated DNA-transfection procedure,” Pro. Natl. Acad. Sci. USA 84:7413-7417. [cited by applicant]
Felgner et al. (1994) “Enhanced Gene Delivery and Mechanism Studies with a Novel Series of Cationic Lipid Formulations,” The Journal of Biological Chemistry 269(4):2550-2561. [cited by applicant]
Ferrin et al. (2020) “Activation of mTOR Signaling Pathway in Hepatocellular Carcinoma,” Int. J. Mol. Sci. 21 (16 pages). [cited by applicant]
Fluiter et al. (2009) “Filling the gap in LNA antisense oligo gapmers: the effects of unlocked nucleic acid (UNA) and 4′-C-hydroxymethyl-DNA modifications on RNase H recruitment and efficacy of an LNA gapmer,” Molecular… [cited by applicant]
Frank-Kamenetsky et al. (2002) “Small-molecule modulators of Hedgehog signaling: identification and characterization of Smoothened agonists and antagonists,” [cited by applicant]
Freier et al. (1997) “The ups and downs of nucleic acid duplex stability: structure-stability studies on chemically-modified DNA:RNA duplexes,” Nucleic Acids Research 25(22):4429-4443. [cited by applicant]
Fukunaga et al. (1984) “Liposome Entrapment Enhances the Hypocalcemic Actions of Parenterally Administered Calcitonin,” Endocrinology 115(2):757-761. [cited by applicant]
Gabizon et al. (1998) “Liposome formulations with prolonged circulation time in blood and enhanced uptake by tumors,” Pro. Natl. Acad. Sci. USA 85:6949-6953. [cited by applicant]
Gao et al. (1991) “A Novel Cationic Liposome Reagent for Efficient Transfection of Mammalian Cells,” Biochemical and Biophysical Research Communications 179(1):280-285. [cited by applicant]
Gershon et al. (1993) “Mode of Formulation and Structural Features of DNA-Cationic Liposome Complexes Used for Transfection,” Biochemistry 32:7143-7151. [cited by applicant]
Grunweller et al. (2003) “Comparison of different antisense strategies in mammalian cells using locked nucleic acids, 2′-O-methyl RNA, phosphorothioates and small interfering RNA,” 31(12):3185-3193. [cited by applicant]
Guatelli et al. (1990) “Isothermal, in vitro amplification of nucleic acids by a multienzyme reaction modeled after retroviral replication,” Proc. Natl. Acad. Sci. USA 87:1874-1878. [cited by applicant]
Guo et al. (Mar. 11, 2022) “Accurate prediction of functional enhancer-promoter interactions using epigenomic data” [Poster presentation]. Systems Biology: Global Regulation of Gene Expression, Cold Spring Harbor, NY, U… [cited by applicant]
Guo et al. (Mar. 2022) “Accurate prediction of functional enhancer-promoter interactions using epigenomic data.” In Abstracts of papers presented at the 2022 meeting on Systems Biology: Global Regulation of Gene Express… [cited by applicant]
Han et al. (2002) “Increased vascular permeability in C1 inhibitor-deficient mice mediated by the bradykinin type 2 receptor,” The Journal of Clinical Investigation 109(8):1057-1063. [cited by applicant]
Hangeland et al. (1995) “Cell-type specific and ligand specific enhancement of cellular uptake of oligodeoxynucleoside methylphosphonates covalently linked with a neoglycopeptide, YEE(ah-GalNAc)3,” [cited by applicant]
Hansen et al. (1965) “Entropy Titration. A Calorimetric Method for the Determination of ?G° (K), ?H° and ?Sº1,” Chemcial Communications 36-38. [cited by applicant]
Henninger et al. (2021) “RNA-mediated feedback control of transcriptional condensates,” Cell 184(1):207-225. [cited by applicant]
Hnisz et al. (2016) “Activation of proto-oncogenes by disruption of chromosome neighborhoods.” Science 351(6280):1454-1458. [cited by applicant]
Hnisz et al. (2016) “Insulated neighborhoods: structural and functional units of mammalian gene control.” Cell 167(5):1188-1200. [cited by applicant]
Hodges et al. (1989) “The spfash mouse: A missense mutation in the ornithine transcarbamylase gene also causes aberrant mRNA splicing,” Proc. Natl. Acad. Sci. USA 86(4142-4146). [cited by applicant]
Holdgate et al. (2005) “Measurements of binding thermodynamics in drug discover,” DDT 10(22):1543-1550. [cited by applicant]
Hu et al. (1994) “Topical delivery of cyclosporin A from non-ionic liposomal systems: an in vivo/in vitro correlation using hairless mouse skin,” S.T.P. Pharma. Sci., 4(6):466-9. [cited by applicant]
International Search Report and Written Opinion for PCT/US2022/082295 mailed May 15, 2023 15 pages. [cited by applicant]
Itani et al. (1987) “A simple and efficient liposome method for transfection of DNA into mammalian cells grown in suspension,” Gene 56:267-376. [cited by applicant]
Jang et al. (2018) “Disease-causingmutations in the promoter and enhancer of the ornithine transcarbamylase gene,” Human Mutation 39:527-536. [cited by applicant]
Jensen et al. (2008) “Unlocked nucleic acid (UNA) and (una derivatives: Thermal denaturation studies,” Nucleic Acids Symposium Series No. 2:133-134. [cited by applicant]
Ji, et al. (2016) “3D chromosome regulatory landscape of human pluripotent cells,” Cell stem cell 18(2):262-275. [cited by applicant]
Jiang et al. (2022) “Ornithine aminotransferase and carbamoyl phosphate synthetase 1 involved in ammonia metabolism serve as novel targets for early stages of gastric cancer,” J Clin Lab Anal. 36:e24692 11 pages. [cited by applicant]
Johansson et al. (2008) “Polymorphisms in the adiponutrin gene are associated with increased insulin secretion and obesity.” European journal of endocrinology 159(5):577-583. [cited by applicant]
Jung et al. (Nov. 18, 2021) “A Novel Treatment Approach for Treating OTC Deficiency By Targeting RegRNAs Using Oligonucleotides” [Conference presentation]. American Liver Foundation 20th Annual Irwin M. Arias Symposium,… [cited by applicant]
Jung et al. (Oct. 2-5, 2022) “Targeting regRNAs with oligonucleotides to treat OTC deficiency” [Poster presentation]. The 18th Annual Meeting of the Oligonucleotide Therapeutics Society, Phoenix, AZ, U.S.A., 1 page. [cited by applicant]
Jung et al. (Sep. 23, 2022) “A Novel Treatment Approach for Treating OTC Deficiency By Targeting RegRNAs Using Oligonucleotides” [Conference presentation]. The 17th Annual Meeting of the Oligonucleotide Therapeutics Soc… [cited by applicant]
Katayama et al. (2007) “Restenosis developing over one year after implantation with a sirolimus-eluting stent: two case reports,” Journal of Cardiology 49(6):345-352. [cited by applicant]
Kim et al. (1983) “Preparation of Multivesicular Liposomes,” Biochimica et Biophysica Acta 728:339-348. [cited by applicant]
Kim et al. (2010) “Widespread transcription at neuronal activity-regulated enhancers,” Nature 465(7295):182-187. [cited by applicant]
Krawczyk et al. (2013) “PNPLA3-Associated Steatohepatitis: Toward a Gene-Based Classification of Fatty Liver Disease,” Semin Liver Dis. 33(4):369-79. [cited by applicant]
Kubrusly et al. (2010) “A role for mammalian target of rapamycin-mTOR-pathway in non alcoholic steatohepatitis related-cirrhosis,” Histology and histopathology 25m:1123-1131. [cited by applicant]
Kumar et al. (2021) “A deep intronic variant is a common cause of OTC deficiency in individuals with previously negative genetic testing,” Mol. Genet. Metab. Rep. 26: 100706. [cited by applicant]
Kwoh et al. (1989) “Transcription-based amplification system and detection of amplified human immunodeficiency virus type 1 with a bead-based sandwich hybridization format,” Pro. Natl. Acad. Sci. USA 86:1173-1177. [cited by applicant]
Lai et al. (2013) “Activating RNAs associate with Mediator to enhance chromatin architecture and transcription,” Nature 494:497-501 7 pages. [cited by applicant]
Lake et al. (2005) “Expression, regulation, and triglyceride hydrolase activity of Adiponutrin family members,” J Lipid Res. 46(11):2477-87. [cited by applicant]
Langer (1990) “New Methods of Drug Delivery,” Articles 1527-1533. [cited by applicant]
Langmead et al. (2012) “Fast gapped-read alignment with Bowtie 2,” Nature methods 9(4):357-359. [cited by applicant]
Langner et al. (2020) “Synthesis and Characterization of Thiophosphoramidate Morpholino Oligonucleotides and Chimeras,” J. Am. Chem. Soc. 142:16240-16253. [cited by applicant]
Li et al. (2009) “The Sequence Alignment/Map Format and SAMtools,” Bioinformatics 25(16):2078-2079. [cited by applicant]
Licciardello et al. (2017) “A combinatorial screen of the CLOUD uncovers a synergy targeting the androgen receptor,” Nature chemical biology 13(7):771-778. [cited by applicant]
Lichter-Konecki (2016) “Defects of the urea cycle,” Translational Science of Rare Disease 1:23-43. [cited by applicant]
Liu (2006) “Radiolabeled Multimeric Cyclic RGD Peptides as Integrin avβ3 Targeted Radiotracers for Tumor Imaging,” Molecular Pharmaceutics 3(5):472-487. [cited by applicant]
Lizardi et al. (1988) “Exponential Amplification of Recombinant-RNA Hybridization Probes,” Bio/technology 6:1197-1201. [cited by applicant]
Love et al. (2010) “Lipid-like materials for lwo-dose, in vivo gene silencing,” PNAS 107(5):1864-1869. [cited by applicant]
Ma et al. (2015) “Co-expression of the carbamoyl-phosphate synthase 1 gene and its long non-coding RNA correlates with poor prognosis of patients with intrahepatic cholangiocarcinoma,” Molecular Medicine Reports 12:7915… [cited by applicant]
Maglio et al. (2014) “The PNPLA3 I148M variant and chronic liver disease: When a genetic mutation meets nutrients,” [cited by applicant]
Mahon et al. (2010) “Combinatorial Approach to Determine Functional Group Effects on Lipidoid-Mediated siRNA Delivery,” Bioconjugate 21:1448-1454. [cited by applicant]
Malley et al. (2016) “The mTOR pathway in obesity driven gastrointestinal cancers: Potential targets and clinical trials.” BBA clinical 5:29-40. [cited by applicant]
Mannino et al. (1998) “Liposome Mediated Gene Transfer,” BioTechniques 6(7):682-690. [cited by applicant]
Mayer et al. (1986) “Vesicles of variable sizes produced by a rapid extrusion procedure,” Biochimica et Biophysica Acta 858:161-168. [cited by applicant]
Mayhew et al. (1984) “Characterization of Liposomes Prepared Using a Microemulsifier,” Biochimica et Biophysica Acta 775:169-174. [cited by applicant]
McTigue et al. (2004) “Sequence-Dependent Thermodynamic Parameters for Locked Nucleic Acid (LNA)-DNA Duplex Formation,” Biochemistry 43:5388-5405. [cited by applicant]
Mergny et al. (2003) “Analysis of Thermal Melting Curves,” Oligonucleotides 13:515-537. [cited by applicant]
Mitsuoka et al. (2009) “A bridged nucleic acid, 2′,4′-BNACOC: synthesis of fully modified oligonucleotides bearing thymine, 5-methylcytosine, adenine and guanine 2′,4′BNACOC monomers and RNA-selective nucleic-acid recog… [cited by applicant]
Moore et al. (2020) “Expanded encyclopaedias of DNA elements in the human and mouse genomes,” Nature 583(7818):699-710 (27 pages). [cited by applicant]
Mori et al. (1987) “Molecular Aspects of Urea Cycle Enzymes and Related Disorders,” Enzyme 38(1-4): 220-6. [cited by applicant]
Morita et al. (2002) “2′-O,4′-C-ethylene-bridged nucleic acids (ENA): highly nuclease-resistant and thermodynamically stable oligonucleotides for antisense drug,” Bioorganic & Med. Chem. Lett. 12(1): 73-6. [cited by applicant]
Morris (2002) “Regulation of Enzymes of the Urea Cycle and Arginine Metabolism,” Annu. Rev. Nutr. 22:87-105. [cited by applicant]
Mousavi et al. (2013) “eRNAs Promote Transcription by Establishing Chomatin Accessibility at Defined Genomic Loci,” Molecular Cell 51:606-617. [cited by applicant]
Muhammad et al. (2020) “Therapeutic Startegies for Cancer Sub-Types Overexpressing Cps1,” Cancer Prevention: Current Research Journal 3(1):114 (4 pages). [cited by applicant]
Mullis et al. (1987) “Specific Synthesis of DNA in Vitro via a Polymerase-Catalyzed Chain Reaction,” Methods in Enzymology 155:335-350. [cited by applicant]
Nabel et al. (1992) “Gene Transfer In Vivo with DNA-Liposome Complexes: Lack of Autoimmunity and Gonadal Localization,” Human Gene Therapy 3:649-656. [cited by applicant]
Nabel et al. (1993) “Direct gene transfer with DNA-liposome complexes in melanoma: Expression, biologic activity, and lack of toxicity in humans,” Pro. Natl. Acad. Sci USA 90:11307-11311. [cited by applicant]
Nakagawa et al. (2009) “SIRT5 Deacetylates carbamoyl phosphate synthetase 1 and regulates the urea cycle,” Cell 137(3):560-570. [cited by applicant]
NC_000012.12: [cited by applicant]
Ni et al. (2019) “Synthetic Approaches for Nucleic Acid Delivery: Choosing the Right Carrier,” Life 9(59) 28 pages. [cited by applicant]
Nicolau et al. (1987) “Liposomes as Carriers for in Vivo Gene Transfer and Expression,” Methods in Enzymology 149:157-176. [cited by applicant]
Nischalke et al. (2011) “The PNPLA3 rs738409 148M/M Genotype Is a Risk Factor for Liver Cancer in Alcoholic Cirrhosis but Shows No or Weak Association in Hepatitis C Cirrhosis,” PLoS One. 6(11):e27087 (6 pages). [cited by applicant]
Ohtake et al. (1986) “Molecular Basis of Ornithine Transcarbamylase Deficiency in spf and spf-ash Mutant Mice,” J. Inherit. Metab. Dis. 9(3): 289-91. [cited by applicant]
Olson et al. (1979) “Preparation of Liposomes of Defined Size Distribution by Extrusion Through Polycarbonate Membranes,” Biochimica et Biophysica Acta 557:9-23. [cited by applicant]
Pal et al. (2005) “Systemic delivery of RafsiRNA using cationic cardiolipin liposomes silences Raf-1 expression and inhibits tumor growth in xenograft model of human prostate cancer,” International Journal of Oncology 2… [cited by applicant]
Papahadjopoulos et al. (1987) “Targeting of Liposomes to Tumor Cells in Vivoa” Annals New York Academy of Sciences 64-74. [cited by applicant]
PCT/US20/27693—International Preliminary Report on Patentability, Sep. 28, 2021, 7 pages. [cited by applicant]
PCT/US20/27693—International Search Report and Written Opinion, Jul. 21, 2020, 17 pages. [cited by applicant]
PCT/US2018/031056—International Search Report and Written Opinion, Oct. 16, 2018, 22 pages. [cited by applicant]
PCT/US2018/031056 International Search Report and Written Opinion, Oct. 16, 2018, 21 pages. [cited by applicant]
PCT/US2018/055087—International Preliminary Report on Patentability, Apr. 16, 2020, 14 pages. [cited by applicant]
PCT/US2018/055087—International Search Report and Written Opinion, Mar. 21, 2019, 21 pages. [cited by applicant]
PCT/US2022/075934—International Search Report and Written Opinion, Jun. 2, 2023, 11 pages. [cited by applicant]
Rahman et al. (2015) “TGF-β/BMP signaling and other molecular events: regulation of osteoblastogenesis and bone formation,” [cited by applicant]
Rajebhosale et al. (2010) “834 Designing Liver Cells Capable of Ammonia Detoxification Useful in Bio-Artificial Liver,” [cited by applicant]
Renet al. (2017) “The combination of blueberry juice and probiotics ameliorate non-alcoholic steatohepatitis (NASH) by affecting SREBP-1c/PNPLA-3 pathway via PPAR-α,” [cited by applicant]
Rivera-Barahona (2015) “Functional Characterization of the spf/ash Splicing Variation in OTC Deficiency of Mice and Man,” PLoS One 10(4): e0122966. [cited by applicant]
Salameh et al. (2016) “PNPLA3 as a genetic determinant of risk for and severity of non-alcoholic fatty liver disease spectrum,” [cited by applicant]
SantaLucia (1998) “A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics,” Proc. Natl. Acad. Sci. USA 95:1460-1465. [cited by applicant]
Sartorelli et al. (2020) “Enhancer RNAs are an important regulatory layer of the epigenome,” Nature Structural & Molecular Biology 27:521-528. [cited by applicant]
Scherer et al. (2006) “The finished DNA sequence of human chromosome 12,” Nature 440(7082):346-351. [cited by applicant]
Schroeder et al. (2009) “Lipid-based nanotherapeutics for siRNA delivery,” Journal of Internal Medicine 267:9-21. [cited by applicant]
Scorletti et al. (2015) “Treating liver fat and serum triglyceride levels in NAFLD, effects of PNPLA3 and TM6SF2 genotypes: results from the WELCOME trial,” [cited by applicant]
Seetin et al. (2012) “RNA Structure Prediction: An Overview of Methods,” Methods in Molecular Biology 905:99-122. [cited by applicant]
Seth et al. (2010) “Synthesis and Biophysical Evaluation of 2′,4′-Constrained 2′O-Methoxyethyl and 2′,4′-Constrained 2′O-Ethyl Nucleic Acid Analogues,” J. Org. Chem. 75:1569-1581.C. [cited by applicant]
Seth et al. (2011) “Pathogens of alcohol induced liver disease: Classical concepts and recent advances,” Journal of Gastroenterology and hepatology 26(7):1089-1105. [cited by applicant]
Sharma et al. (2018) “Novel Cluster and Monomer-Based GalNAc Structures Induce Effective Uptake of siRNAs in Vitro and in Vivo,” Bioconjugate Chem. 29:2478-2488. [cited by applicant]
Siegwart et al. (2011) “Combinatorial synthesis of chemically diverse core-shell nanoparticles for intracellular delivery,” PNAS 108(32):12996-13001. [cited by applicant]
Sigova et al. (2015) “Transcription factor trapping by RNA in gene regulatory elements,” Science 350(6263):978-981. [cited by applicant]
Smith et al. (Sep. 23, 2021) “Oligonucleotide Mediated Upregulation of Serping1 By Targeting Regulatory RNAs” [Conference presentation]. The 17th Annual Meeting of the Oligonucleotide Therapeutics Society, Virtual Meeti… [cited by applicant]
Smith et al. (Oct. 2-5, 2022) “Upregulation of SerpinG1 for treatment of hereditary angioedema using RNA actuators” [Poster presentation]. The 18th Annual Meeting of the Oligonucleotide Therapeutics Society, Phoenix, AZ… [cited by applicant]
Sorensen et al. (2003) “Gene Silencing by Systemic Delivery of Synthetic siRNAs in Adult Mice,” J. Mol. Biol. 327:761-766. [cited by applicant]
Stewart et al. (1980) “Short Term Regulation of Ureagenesis,” The Journal of Biological Chemistry 255(11):5270-5280. [cited by applicant]
Straubinger et al. (1983) “Liposomes as Carriers for Intrcellular Delivery of Nucleic Acids,” Methods in Enzymology 101:512:527. [cited by applicant]
Strauss et al. (1992) “Molecular complementation of a collagen mutation in mammalian cells using yeast artificial chromosomes,” The EMBO Journal 11(2):417-422. [cited by applicant]
Sugimoto et al. (1995) “Thermodynamic Parameters to Predict Stability of RNA/DNA Hybrid Duplexes,” Biochemistry 34:11211-11216. [cited by applicant]
Suter et al. (2011) “Mammalian Genes Are Transcribed with Widely Different Bursting Kinetics,” Science 332(6028):472-474. [cited by applicant]
Szoka et al. (1978) “Procedure for preparation of liposomes with large internal aqueous space and high capture by reverse-phase evaporation,” Pro. Natl. Acad. Sci. USA 75(9):4194-4198. [cited by applicant]
Takiguchi et al. (1995) “Transcriptional regulation of genes for ornithine cycle enzymes,” Biochem. J. 312:649-659. [cited by applicant]
Tian et al. (2010) “Variant in PNPLA3 is associated with alcoholic liver disease,” Nature Genetics 42:21-23. [cited by applicant]
Tomalia et al. (2007) “Dendrimers as multi-purpose nanodevices for oncology drug delivery and diagnostic imaging,” Biochemical Society Transactions 35:61-67. [cited by applicant]
Trépo et al. (2016) “PNPLA2 gene in liver diseases,” J Hepatol. 65(2):399-412. [cited by applicant]
Uhlmann et al. (2000) “Recent advances in the medicinal chemistry of antisense oligonucleotides,” Current Opinion in Drug Discovery & Development 3(2):203-213. [cited by applicant]
Unzu et al. (2010) “Porphobilinogen deaminase over-expression in hepatocytes, but not in erythrocytes, prevents accumulation of toxic porphyrin precursors in a mouse model of acute intermittent porphyria,” [cited by applicant]
Verma et al. (2003) “Small Interfering RNAs Directed against b-Catenin Inhibit the in Vitro and in Vivo Growth of Colon Cancer Cells,” Clinical Cancer Research 9:1291-1300. [cited by applicant]
Wakiya et al. (2012) “Impact of enzyme activity assay on indication in liver transplantation for ornithine transcarbamylase deficiency,” Mol. Gen. Med. 105: 404-7. [cited by applicant]
Wan et al. (2016) “The Medicinal Chemistry of Therapeutic Oligonucleotides,” J. Med. Chem. 59:9645-9667. [cited by applicant]
Wang et al. (1987) “pH-sensitive immunoliposomes mediate target-cell-specific delivery and controlled expression of a foreign gene in mouse,” Proc. Natl. Acad. Sci. USA 84:7851-7855. [cited by applicant]
Wang et al. (1987) “Plasmid DNA Adsorbed to pH-Sensitive Liposomes Efficiently Transforms the Target Cells,” Biochemical and Biophysical Research Communications 147(3):980-985. [cited by applicant]
Wang et al. (2016) “Long noncoding RNA CPS1-IT1 suppresses the metastasis of hepatocellular carcinoma by regulating HIF-1a activity and inhibiting epithelial-mesenchymal transition,” Oncotarget 7(28): 43588-43603. [cited by applicant]
Wang et al. (2018) “Fenofibrate exerts protective effects in diabetic retinopathy via inhibition of the ANGPTL3 pathway,” [cited by applicant]
Wei et al. (2000) “IL-4 and IL-13 upregulate arginase I expression by cAMP and JAK/STAT6 pathways in vascular smooth muscle cells,” American Journal of Physiology-Cell Physiology 279(1):C248-C256. [cited by applicant]
Weiner et al. (1994) “Liposomes: A Novel Topical Delivery System for Pharmaceutical and Cosmetic Applications,” Journal of Drug Targeting 2:405-410. [cited by applicant]
Willoughby et al. (2018) “Evaluation of GalNAc-siRNA Conjugate Activity in Pre-clinical Animal Models with Reduced Asialoglycoprotein Receptor Expression,” Molecular Therapy 26(1):105-114 (12 pages). [cited by applicant]
Wong et al. (2012) “Hedgehog signaling is required for differentiation of endocardial progenitors in zebrafish,” [cited by applicant]
Wu et al. (1993) “Increased Microvascular Permeability Contributes to Preferential Accumulation of Stealth1 Liposomes in Tiimor Tissue2,” Cancer Research 53:3765-3770. [cited by applicant]
Yilmaz et al. (2009) “Serum concentrations of human angiopoietin-like protein 3 in patients with nonalcoholic fatty liver disease: association with insulin resistance,” Eur J Gastroenterol Hepatol 21:1247-1251. [cited by applicant]
Yiu et al., “Glucose-6-phosphate transporter gene therapy corrects metabolic and myeloid abnormalities in glycogen storage disease type Ib mice.” [cited by applicant]
Yoo et al. (1999) “PAMAM Dendrimers as Delivery Agents for Antisense Oligonucleotides,” Pharmaceutical Research 16(12):1799-1804. [cited by applicant]
Yu et al. (2022) “Deliver the promise: RNAs as a new class ofmolecular entities for therapy and vaccination,” Pharmacology & Therapeutics 230:107967, 19 pages. [cited by applicant]
Yun et al. (2011) “EC144, a synthetic inhibitor of heat shock protein 90, blocks innate and adaptive immune responses in models of inflammation and autoimmunity,” [cited by applicant]
Zhang et al. (2008) “Model-based Analysis of ChIP-Seq (MACS),” Genome biology 9(9):1-9. [cited by applicant]
Zhang et al. (2010) “Synthesis of Glycerol Nucleic Acid (GNA) Phosphoramidite Monomers and Oligonucleotide Polymers,” Current Protocols in Nucleic Acid Chemistry 4.40.1-4.40.18 (18 pages). [cited by applicant]
Zhao et al. (2021) “Review of machine learningmethods for RNA secondary structure prediction,” PLOS Computational Biology 1-22. [cited by applicant]
Zhou et al. (1991) “Lipophilic polylysines mediate efficient DNA transfection in mammalian cells,” Biochimica et Biophysica Acta 1065:8-14. [cited by applicant]
Zhou et al. (1992) “Targeted delivery of DNA by liposomes and polymers,” Journal of Controlled Release 19:269-274. [cited by applicant]
Zhou et al. (2009) “Fine Tuning of Electrostatics around the Internucleotidic Phosphate through Incorporation of Modified 2',4′-Carbocyclic-LNAs and -ENAs Leads to Significant Modulation of Antisense Properties,” J. Org… [cited by applicant]
Zimmermann et al. (2006) “RNAi-mediated gene silencing in non-human primates,” Nature 441:111-114. [cited by applicant]
PCT/US2022/082295—International Preliminary Report on Patentability, Jun. 20, 2024, 7 pages. [cited by applicant]