Granted Patent B2

US 11,117,933 · App. 16/680,402 · Granted Sep 14, 2021

Inventors: Benjamin E. Deverman (Pasadena, CA); Paul H. Patterson (Altadena, CA); Viviana Gradinaru (La Cañada Flintridge, CA)

Assignee: California Institute of Technology

C07K14/005A61K38/1709A61K38/2093A61K38/47A61K38/4813A61K38/50A61K39/3955A61K48/005A61K48/0058C07K7/06C12N7/00C12N15/1068C12N15/86A61K38/00C07K2319/33C12N2750/14122C12N2750/14143C12N2750/14145C12N2810/6027C12Y304/14009C12Y305/01015

Abstract

Claims (23)

1. An AAV polynucleotide comprising a capsid sequence, wherein said capsid sequence (a) encodes an AAV capsid protein, (b) has at least 99% identity to SEQ ID NO: 11, and (c) comprises a nucleotide sequence which (i) comprises at least 12 nucleotides from the sequence ACGCGGACTAATCCTGAGGCT (SEQ ID NO: 51) and encodes at least 4 contiguous amino acids from the sequence TRTNPEA (SEQ ID NO: 56), or (ii) comprises at least 12 nucleotides from the sequence AGTGTGAGTAAGCCTTTTTTG (SEQ ID NO: 26) and encodes at least 4 contiguous amino acids from the sequence SVSKPFL (SEQ ID NO: 28).

2. The AAV polynucleotide of claim 1 , wherein the capsid sequence comprises a nucleotide sequence which comprises at least 12 nucleotides from the sequence ACGCGGACTAATCCTGAGGCT (SEQ ID NO: 51) and encodes at least 4 contiguous amino acids from the sequence TRTNPEA (SEQ ID NO: 56).

3. The AAV polynucleotide of claim 1 , wherein the capsid sequence comprises a nucleotide sequence which comprises at least 18 nucleotides from the sequence ACGCGGACTAATCCTGAGGCT (SEQ ID NO: 51) and which encodes at least 6 contiguous amino acids from the sequence TRTNPEA (SEQ ID NO: 56).

4. The AAV polynucleotide of claim 1 , wherein the capsid sequence comprises ACGCGGACTAATCCTGAGGCT (SEQ ID NO: 51).

5. The AAV polynucleotide of claim 1 , wherein the capsid sequence comprises ACGCGGACTAATCCTGAGGCT (SEQ ID NO: 51) inserted between two nucleotides in the capsid sequence which correspond to nucleotides 1764 and 1765 of SEQ ID NO: 11.

6. The AAV polynucleotide of claim 1 , wherein the capsid sequence comprises a nucleotide sequence which comprises at least 12 nucleotides from the sequence AGTGTGAGTAAGCCTTTTTTG (SEQ ID NO: 26) and encodes at least 4 contiguous amino acids from the sequence SVSKPFL (SEQ ID NO: 28).

7. The AAV polynucleotide of claim 1 , wherein the capsid sequence comprises a nucleotide sequence which comprises at least 18 nucleotides from the sequence AGTGTGAGTAAGCCTTTTTTG (SEQ ID NO: 26) and encodes at least 6 contiguous amino acids from the sequence SVSKPFL (SEQ ID NO: 28).

8. The AAV polynucleotide of claim 1 , wherein the capsid sequence comprises AGTGTGAGTAAGCCTTTTTTG (SEQ ID NO: 26).

9. The AAV polynucleotide of claim 1 , wherein the capsid sequence comprises AGTGTGAGTAAGCCTTTTTTG (SEQ ID NO: 26) inserted between two nucleotides in the capsid sequence which correspond to nucleotides 1764 and 1765 of SEQ ID NO: 11.

10. An AAV capsid protein encoded by an AAV polynucleotide comprising a capsid sequence, wherein said capsid sequence (a) encodes said AAV capsid protein, (b) has at least 99% identity to SEQ ID NO: 11, and (c) comprises a nucleotide sequence which (i) comprises at least 12 nucleotides from the sequence ACGCGGACTAATCCTGAGGCT (SEQ ID NO: 51) and encodes at least 4 contiguous amino acids from the sequence TRTNPEA (SEQ ID NO: 56), or (ii) comprises at least 12 nucleotides from the sequence AGTGTGAGTAAGCCTTTTTTG (SEQ ID NO: 26) and encodes at least 4 contiguous amino acids from the sequence SVSKPFL (SEQ ID NO: 28).

11. The AAV capsid protein of claim 10 , wherein the AAV capsid protein comprises a capsid amino acid sequence having at least 99% identity to SEQ ID NO: 2.

12. The AAV capsid protein of claim 11 , wherein the capsid amino acid sequence comprises at least 4 contiguous amino acids from the sequence TRTNPEA (SEQ ID NO: 56).

13. The AAV capsid protein of claim 11 , wherein the capsid amino acid sequence comprises at least 6 contiguous amino acids from the sequence TRTNPEA (SEQ ID NO: 56).

14. The AAV capsid protein of claim 11 , wherein the capsid amino acid sequence comprises TRTNPEA (SEQ ID NO: 56).

15. The AAV capsid protein of claim 11 , wherein the capsid amino acid sequence comprises TRTNPEA (SEQ ID NO: 56) inserted between two amino acids in the capsid amino acid sequence which correspond to amino acids 588 and 589 of SEQ ID NO: 2.

16. The AAV capsid protein of claim 10 , wherein the capsid amino acid sequence comprises TRTNPEA (SEQ ID NO: 56).

17. The AAV capsid protein of claim 10 , wherein the capsid amino acid sequence comprises TRTNPEA (SEQ ID NO: 56) inserted between two amino acids in the capsid amino acid sequence which correspond to amino acids 588 and 589 of SEQ ID NO: 2.

18. The AAV capsid protein of claim 11 , wherein the capsid amino acid sequence comprises at least 4 contiguous amino acids from the sequence SVSKPFL (SEQ ID NO: 28).

19. The AAV capsid protein of claim 11 , wherein the capsid amino acid sequence comprises at least 6 contiguous amino acids from the sequence SVSKPFL (SEQ ID NO: 28).

20. The AAV capsid protein of claim 11 , wherein the capsid amino acid sequence comprises SVSKPFL (SEQ ID NO: 28).

21. The AAV capsid protein of claim 11 , wherein the capsid amino acid sequence comprises SVSKPFL (SEQ ID NO: 28) inserted between two amino acids in the capsid amino acid sequence which correspond to amino acids 588 and 589 of SEQ ID NO: 2.

22. The AAV capsid protein of claim 10 , wherein the capsid amino acid sequence comprises SVSKPFL (SEQ ID NO: 28).

23. The AAV capsid protein of claim 10 , wherein the capsid amino acid sequence comprises SVSKPFL (SEQ ID NO: 28) inserted between two amino acids in the capsid amino acid sequence which correspond to amino acids 588 and 589 of SEQ ID NO: 2.

Assignments (1)

Continuity (9)