IP Library Granted Patent US 12,612,643
Granted Patent B2
US 12,612,643 · App. 17/186,139 · Granted Apr 28, 2026

RNA-guided human genome engineering

Inventors: George M. Church (Brookline, MA); Prashant G. Mali (La Jolla, CA); Luhan Yang (Somerville, MA)
Assignee: President and Fellows of Harvard College
C12N15/85C12N9/22C12N15/01C12N15/10C12N15/102C12N15/1024C12N15/63C12N15/81C12N15/8201C12N15/87C12N15/90C12N15/907C12N2310/20C12N2800/80C12N2810/55C12Y301/00
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 12,612,643
App. No.
17/186,139
Granted
Apr 28, 2026
Kind
B2
Abstract

A method of altering a eukaryotic cell is provided including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.

Claims (22)

1 . A method of targeting a nuclease null Cas9 protein to a target nucleic acid sequence in a eukaryotic cell comprising

providing the eukaryotic cell with a guide RNA sequence or a first nucleic acid sequence encoding the guide RNA sequence, wherein the guide RNA sequence comprises a spacer sequence and a scaffold sequence, wherein the spacer sequence is complementary to the target nucleic acid sequence,

providing the eukaryotic cell with the nuclease null Cas9 protein, or a second nucleic acid sequence encoding the nuclease null Cas9 protein,

wherein the guide RNA sequence and the nuclease null Cas9 protein form a colocalization complex at the target nucleic acid sequence, and

wherein the guide RNA sequence is a crRNA-tracrRNA fusion transcript comprising GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC (SEQ ID NO:46).

2 . The method of claim 1 wherein the guide RNA sequence has a secondary structure comprising a first hairpin and a second 3′ hairpin.

3 . The method of claim 1 wherein the first nucleic acid sequence encoding the guide RNA sequence further comprises a regulatory element operable in a eukaryotic cell.

4 . The method of claim 1 wherein the first nucleic acid sequence encoding the guide RNA sequence further comprises a human U6 polymerase III promoter.

5 . The method of claim 1 wherein the second nucleic acid sequence encoding the nuclease null Cas9 protein is a human codon optimized nucleic acid.

6 . The method of claim 1 wherein the second nucleic acid sequence encoding the nuclease null Cas9 protein is a human codon optimized nucleic acid encoding a nuclear localization signal.

7 . The method of claim 1 wherein the second nucleic acid sequence encoding the nuclease null Cas9 protein is a human codon optimized nucleic acid encoding a C-terminal nuclear localization signal.

8 . The method of claim 1 wherein the second nucleic acid sequence encoding the nuclease null Cas9 protein is a human codon optimized nucleic acid encoding a C-terminal SV40 nuclear localization signal.

9 . The method of claim 1 wherein the second nucleic acid sequence encoding the nuclease null Cas9 protein is a human codon optimized nucleic acid comprising a regulatory element operable in a eukaryotic cell.

10 . The method of claim 1 wherein the second nucleic acid sequence encoding the nuclease null Cas9 protein is a human codon optimized nucleic acid comprising a CMV promoter.

11 . The method of claim 1 wherein the nuclease null Cas9 protein comprises a nuclease null S. pyogenes Cas9 protein.

12 . The method of claim 1 wherein the eukaryotic cell is a yeast cell, a plant cell or a mammalian cell.

13 . The method of claim 1 wherein the eukaryotic cell is a human cell.

14 . The method of claim 1 wherein the guide RNA sequence includes between 100 to 250 nucleotides.

15 . The method of claim 1 wherein the eukaryotic cell is a stem cell.

16 . The method of claim 1 wherein the eukaryotic cell is a human stem cell.

17 . The method of claim 1 wherein the eukaryotic cell is a human induced pluripotent stem cell.

18 . The method of claim 5 , wherein the eukaryotic cell is a human induced pluripotent stem cell.

Assignments (1)
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded May 6, 2022
From: CHURCH, GEORGE M.; MALI, PRASHANT; YANG, LUHAN
To: PRESIDENT AND FELLOWS OF HARVARD COLLEGE
Reel/Frame 059843/0397 →
Continuity (7)
Continuation 16884327 · May 27, 2020
Continuation 16397423 · Apr 29, 2019
Continuation 14790147 · Jul 2, 2015
Continuation 14653144
Provisional Application 61779169 · Mar 13, 2013
Provisional Application 61738355 · Dec 17, 2012
Related Publication 20210222193A1 · Jul 22, 2021
References Cited (281)
US 6039784A · Luk · 2000 [cited by applicant]
US 6534261B1 · Cox, III et al. · 2003 [cited by applicant]
US 6586240B1 · Singer et al. · 2003 [cited by applicant]
US 8697359B1 · Zhang · 2014 [cited by applicant]
US 8795965B2 · Zhang · 2014 [cited by applicant]
US 8871445B2 · Cong et al. · 2014 [cited by applicant]
US 8889394B2 · Chalasani · 2014 [cited by applicant]
US 8906616B2 · Zhang et al. · 2014 [cited by applicant]
US 8932814B2 · Cong et al. · 2015 [cited by applicant]
US 8993233B2 · Zhang et al. · 2015 [cited by applicant]
US 8999641B2 · Zhang et al. · 2015 [cited by applicant]
US 9023649B2 · Mali et al. · 2015 [cited by applicant]
US 9267135B2 · Church et al. · 2016 [cited by applicant]
US 9587252B2 · Church · 2017 [cited by examiner]
US 9970024B2 · Church · 2018 [cited by examiner]
US 10329587B2 · Church · 2019 [cited by examiner]
US 10375938B2 · Church et al. · 2019 [cited by applicant]
US 10435708B2 · Mali et al. · 2019 [cited by applicant]
US 10526618B2 · Esvelt et al. · 2020 [cited by applicant]
US 10640789B2 · Church · 2020 [cited by examiner]
US 10717990B2 · Mali · 2020 [cited by examiner]
US 10767194B2 · Church et al. · 2020 [cited by applicant]
US 10851380B2 · Kim et al. · 2020 [cited by applicant]
US 10959413B2 · Church et al. · 2021 [cited by applicant]
US 11236359B2 · Mali et al. · 2022 [cited by applicant]
US 11359211B2 · Church · 2022 [cited by examiner]
US 11365429B2 · Church et al. · 2022 [cited by applicant]
US 11459585B2 · Church et al. · 2022 [cited by applicant]
US 11512325B2 · Church et al. · 2022 [cited by applicant]
US 11535863B2 · Church et al. · 2022 [cited by applicant]
US 11649469B2 · Church et al. · 2023 [cited by applicant]
US 11746349B2 · Church · 2023 [cited by examiner]
US 11981917B2 · Church et al. · 2024 [cited by applicant]
US 12018272B2 · Church · 2024 [cited by examiner]
US 20030149254A1 · Anderson et al. · 2003 [cited by applicant]
US 20050220796A1 · Dynan et al. · 2005 [cited by applicant]
US 20050233994A1 · Kaykas et al. · 2005 [cited by applicant]
US 20100076057A1 · Sontheimer et al. · 2010 [cited by applicant]
US 20100093617A1 · Barrangou et al. · 2010 [cited by applicant]
US 20110059502A1 · Chalasani · 2011 [cited by applicant]
US 20110189776A1 · Terns et al. · 2011 [cited by applicant]
US 20110223638A1 · Wiedenheft et al. · 2011 [cited by applicant]
US 20110301073A1 · Gregory et al. · 2011 [cited by applicant]
US 20120025518A1 · Kuranishi et al. · 2012 [cited by applicant]
US 20120060230A1 · Collingwood et al. · 2012 [cited by applicant]
US 20130130248A1 · Haurwitz et al. · 2013 [cited by applicant]
US 20130253040A1 · Miller et al. · 2013 [cited by applicant]
US 20140068797A1 · Doudna et al. · 2014 [cited by applicant]
US 20140179006A1 · Zhang · 2014 [cited by applicant]
US 20140179770A1 · Zhang et al. · 2014 [cited by applicant]
US 20140242699A1 · Zhang · 2014 [cited by applicant]
US 20140256046A1 · Zhang et al. · 2014 [cited by applicant]
US 20140310830A1 · Zhang et al. · 2014 [cited by applicant]
US 20140315985A1 · May et al. · 2014 [cited by applicant]
US 20140335620A1 · Zhang et al. · 2014 [cited by applicant]
US 20140342456A1 · Mali et al. · 2014 [cited by applicant]
US 20150031132A1 · Church et al. · 2015 [cited by applicant]
US 20150031133A1 · Church et al. · 2015 [cited by applicant]
US 20150166969A1 · Takeuchi et al. · 2015 [cited by applicant]
US 20150232833A1 · Mali et al. · 2015 [cited by applicant]
US 20150247150A1 · Zhang et al. · 2015 [cited by applicant]
US 20150259704A1 · Church et al. · 2015 [cited by applicant]
US 20150284727A1 · Kim et al. · 2015 [cited by applicant]
US 20150291965A1 · Zhang et al. · 2015 [cited by applicant]
US 20150322457A1 · Kim et al. · 2015 [cited by applicant]
US 20160002670A1 · Church et al. · 2016 [cited by applicant]
US 20160017366A1 · Chen et al. · 2016 [cited by applicant]
US 20160153006A1 · Zhang et al. · 2016 [cited by applicant]
US 20160160210A1 · Mali et al. · 2016 [cited by applicant]
US 20160237456A1 · Church et al. · 2016 [cited by applicant]
US 20160298134A1 · Chen et al. · 2016 [cited by applicant]
US 20160340662A1 · Zhang et al. · 2016 [cited by applicant]
US 20160355795A1 · Ran et al. · 2016 [cited by applicant]
US 20170191078A1 · Zhang et al. · 2017 [cited by applicant]
US 20170191082A1 · Chen et al. · 2017 [cited by applicant]
US 20200277631A1 · Doudna et al. · 2020 [cited by applicant]
CA 2534296C · 2013 [cited by applicant]
JP 2007501626A · 2007 [cited by applicant]
JP 2009136298A · 2009 [cited by applicant]
JP 2011207893A · 2011 [cited by applicant]
JP 2016500003A · 2016 [cited by applicant]
JP 2016502840A · 2016 [cited by applicant]
JP 2016504026A · 2016 [cited by applicant]
KR 20150107739A · 2015 [cited by applicant]
WO 2008108989A2 · 2008 [cited by applicant]
WO 2010054108A2 · 2010 [cited by applicant]
WO 2011143124A2 · 2011 [cited by applicant]
WO 2011146121A1 · 2011 [cited by applicant]
WO 2012164565A1 · 2012 [cited by applicant]
WO 2013098244A1 · 2013 [cited by applicant]
WO 2013126794A1 · 2013 [cited by applicant]
WO 2013141680A1 · 2013 [cited by applicant]
WO 2013142578A1 · 2013 [cited by applicant]
WO 2013176772A1 · 2013 [cited by applicant]
WO 2014022702A2 · 2014 [cited by applicant]
WO 2014065596A1 · 2014 [cited by applicant]
WO 2014089290A1 · 2014 [cited by applicant]
WO 2014093595A1 · 2014 [cited by applicant]
WO 2014093622A2 · 2014 [cited by applicant]
WO 2014093655A2 · 2014 [cited by applicant]
WO 2014093712A1 · 2014 [cited by applicant]
WO 2014099744A1 · 2014 [cited by applicant]
WO 2014093718A1 · 2014 [cited by applicant]
Miyagishi et al., “Gene knockdown method using siRNA expression vector and its problems,” Jikken Igaku (Experimental Medicine), vol. 22, No. 4, pp. 477-484 (2004). [cited by applicant]
Morita et al., “RNAi provides a new tool for functional analyses of the mammalian genes,” Tanpakushitsu kakusan kouso (Protein, nucleic acid, enzyme), vol. 47, No. 14, pp. 1939-1945 (2002). [cited by applicant]
Minoshima et al., “RNAi-mediated specific gene silencing and its application to medical treatments of viral infectious disease,” Uirusu (Virus), vol. 53, No. 1, pp. 7-14 (2003). [cited by applicant]
Ma, S. et al., “Highly Efficient and Specific Genome Editing in Silkworm Using Costom TALENs.” PLoS One, vol. 7(9), e45035 (2012). [cited by applicant]
Reiss, B. et al., “RecA protein stimulates homologous recombination in plants.” PNAS, vol. 93, pp. 3094-3098 (1996). [cited by applicant]
Sauer, B. et al., “Site-specific DNA recombination in mammalian cells by the Cre recombinase of bacteriophage P1.” Proc. Natl. Acad. Sci. USA, vol. 85(14), pp. 5166-5170 (1988). [cited by applicant]
Groth, A. et al., “A phage integrase directs efficient site-specific integration in human cells,” Proc. Natl. Acad. Sci. USA, vol. 97(11), pp. 5995-6000 (2000). [cited by applicant]
Chapdelaine, P. et al., “Meganucleases can restore the reading frame of a mutated dystrophin.” Gene Therapy, vol. 17, pp. 846-858 (2010). [cited by applicant]
Mastroianni, M. et al., “Group II Intron-Based Gene Targeting Reactions in Eukaryotes.” PLoS One, vol. 3(9), e3121 (2008). [cited by applicant]
Morgan, W. et al., “Inducible Expression and Cytogenetic Effects of the EcoRI Restriction Endonuclease in Chinese Hanster Ovary Cells.” Molecular and Cellular Biology, vol. 8(10), pp. 4204-4211 (1988). [cited by applicant]
Carney, J. et al., “Induction of DNA Double-Strand Breaks by Electrocorporation of Restriction Enzymes into Mammalian Cells.” Methods in Mol. Biol., vol. 113, pp. 465-471 (1999). [cited by applicant]
Schiestl, R. et al., “Integration of DNA fragments by illegitimate recombination in [cited by applicant]
Kuspa, A. et al., “Tagging developmental genes in Dictyostelium by restriction enzyme-mediated integration of plasmid DNA.” Proc. Natl. Acad. Sci. USA, vol. 89(18), pp. 8803-8807 (1992). [cited by applicant]
Gopalan, V. et al., “RNase P Variations and Uses.” The Journal of Biological Chemistry, vol. 277(9), pp. 6759-6762 (2002). [cited by applicant]
Link, K. et al., “Engineering ligand-responsive gene-control elements: lessons learned from natural riboswitches.” Gene Therapy, vol. 16(10), pp. 1189-1201 (2009). [cited by applicant]
Wieland, M. et al., “Engineering of ribozyme-based riboswitches for mammalian cells.” Methods, vol. 56., pp. 351-357 (2012). [cited by applicant]
Fieck, A. et al., “Modifications of the [cited by applicant]
Planey, S. et al., “Mechanisms of Signal Transduction: Inhibition of Glucocorticoid-induced Apoptosis in 697 Pre-B Lymphocytes by the Mineralocorticoid Receptor N-terminal Domain.” J. Biol. Chem, vol. 277(44), pp. 42188… [cited by applicant]
Lange, A. et al., “Classical Nuclear Localization Signals: Definition, Function, and Interaction with Importin a*s.” J. Biol. Chem, vol. 282(8), pp. 5101-5105 (2007). [cited by applicant]
Notice of Opposition—James Poole Ltd., filed Nov. 4, 2019. [cited by applicant]
Notice of Opposition—Patent Boutique LLP, filed Feb. 14, 2020. [cited by applicant]
Notice of Opposition—Mathys & Squire LLP, filed Feb. 14, 2020. [cited by applicant]
Notice of Opposition—George Schlich, filed Feb. 17, 2020. [cited by applicant]
Lee, H. et al., “Targeted chromosomal duplications and inversions in the human genome using zinc finger nucleases.” Genome Res., vol. 22, pp. 539-548 (2012). [cited by applicant]
Ramirez, C. et al., “Engineered zinc finger nickases induce homology-directed repair with reduced mutagenic effects.” Nucleic Acid Res., vol. 40(12), pp. 5560-5568 (2012). [cited by applicant]
U.S. Appl. No. 61/835,931, filed Jun. 17, 2013—Zhang et al. [cited by applicant]
Gasiunas et al., “Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria” PNAS, Sep. 25, 2012, 109(39) E2579-E2586. [cited by applicant]
Office Action & Search Report issued Jul. 6, 2020 for RU 2019127316. [cited by applicant]
Liu et al., “Combinatorial RNAi Against HIV-1 Using Extended Short Hairpin RNAs,” Molecular Therapy, vol. 17, No. 10, pp. 1712-1723 (2009). [cited by applicant]
Pougach et al., “CRISPR Adaptive Immunity Systems of Prokaryotes,” Molecular Biology, vol. 46, No. 2, pp. 175-182 (2012). [cited by applicant]
Mar. 20, 2020—Third Office Action issued for MX/a/2015/007743. [cited by applicant]
Aug. 2, 2020—(NZ) Examination Report issued for App. No. 709429. [cited by applicant]
Aug. 11, 2020—(US) Third Party Submission—U.S. Appl. No. 16/439,840. [cited by applicant]
Sep. 23, 2020—(KR) Notice of Preliminary Rejection—App. No. 10-2015-7018831. [cited by applicant]
Sep. 1, 2020—(JP) Decision of Refusal—App. No. 2018-230081. [cited by applicant]
Oct. 23, 2020 (US)—Non-Final Office Action—U.S. Appl. No. 15/042,573. [cited by applicant]
Dec. 24, 2020—(US) Non-Final Office Action—U.S. Appl. No. 16/397,213. [cited by applicant]
Feb. 1, 2021—(US) Non-Final Office Action—U.S. Appl. No. 15/760,569. [cited by applicant]
Jan. 25, 2021—(RU) Office Action—App. No. 2019127316. [cited by applicant]
Ran Ann F et al., Genome engineering using the CRISPR-Cas9 system, Nature Protocols, Nature Publishing Group, vol. 8, No. 11, Nov. 1, 2013. [cited by applicant]
Jinek Martin et al., “A Programmable Dual-RNA—Guided DNA Endonuclease in Adaptive Bacterial Immunity”, Science, vol. 339, No. 6096, Aug. 17, 2012. [cited by applicant]
Fujii Wataru et al., “Efficient generation of large-scale genome-modified miice using gRNA and CAS9 endonuclease”, Nucleic Acids Research, vol. 4, No. 20, Aug. 20, 2013. [cited by applicant]
The ABCs of Gene Cloning, 93-124 (2005). [cited by applicant]
Gene Transfer and Expression in Mammalian Cells, Table 1 (2003). [cited by applicant]
Handel, E. et al. Versatile and efficient genome editing in human cells by combining zinc-finger nucleases with adeno-associated viral vectors. Human Gene Ther. 23:321-329 (2012). [cited by applicant]
Urnov, F. et al. “Genome editing with engineered zinc finer nucleases.” Nat. Rev. Gene. 11, 636-646 (2010). [cited by applicant]
Zhang, F. et al. “Programmable Sequence-Specific Transcriptional Regulation of Mammalian Genome Using Designer TAL Effectors.” Nature Biotechnol. vol. 29(2): 149-153 (2011). [cited by applicant]
Sanjana, N. et al. “A Transcription Activator-Like Effector (TALE) Toolbox for Genome Engineering.” Nat. Proto. vol. 7(1):171-192 (2011). [cited by applicant]
Cong, L. et al. “Comprehensive Interrogation of Natural TALE DNA Binding Modules and Transcriptional Repressor Domains.” Nature Commun. 3:968 (2012). [cited by applicant]
Dominguez, A. et al. “Beyond editing: repurposing CRISPR-Cas9 for precision genome regulation and interrogation.” Nat. Rev. Mol. Cell Biol. 17(1): 5-15 (2016). [cited by applicant]
“Lipofectamine 2000 Transfection Reagent” (ThermoFisher Scientific website). [cited by applicant]
Molecular Biology of the Cell, Fifth Ed., 699-707 (2008). [cited by applicant]
Cermak, T. et al. “Efficient design and assemly of custom TALEN and other TAL effector-based constructs for DNA targeting.” Nucleic Acids Research. vol. 39, No. 12 e82 (2011). [cited by applicant]
Kuzmine, I. et al. “Binding of the priming nucleotide in the initiation of transcription by T7 RNA polymerase.” J. Biol. Chem. 278(5): 2819-2823 (2003). [cited by applicant]
Brouns, S. “A Swiss Army Knife of Immunity.” Science, vol. 337, 808-809 (2012). [cited by applicant]
Christian, M. et al. “Targeting DNA Double-Strand Breaks with TAL Effector Nucleases,” Genetics, vol. 186, pp. 757-761 (2010). [cited by applicant]
“Transcription activator-like effector nuclease,” Wikipedia, Nov. 16, 2012. [cited by applicant]
Le Provost, F. et al, “Zinc finger nuclease technology heralds a new era in mammalian transgenesis,” Trends in Biotechnology, vol. 28(3), pp. 134-141 (2009). [cited by applicant]
Singer, O. et al., “Applications of Lentiviral Vectors for shRNA Delivery and Transgenesis,” Curr. Gene Ther., vol. 8(6), pp. 483-488 (2008). [cited by applicant]
Cho, S. et al., “Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease,” Nature Biotechnol., vol. 31(3), pp. 230-232 (2013), plus Supplementary Materials. [cited by applicant]
Barrangou, R. “RNA-mediated programmable DNA cleavage.” Nat. Biotechnol., vol. 30(9), pp. 836-838 (2012). [cited by applicant]
Declaration and Curriculum Vitae of Dr. Gang Bao. [cited by applicant]
Hockemeyer, D. et al. “Gene Targeting in Human Pluripotent Cells.” Cold Spring Harbor Symposia for Quantitative Biology, vol. 75, pp. 201-209 (2010). [cited by applicant]
Gantz, J. et al. “Targeted Genomic Integration of a Selectable Floxed Dual Fluorescence Reporter in Human Embryonic Stem Cells.” PLOS One, vol. 7(10):e46971 (2012). [cited by applicant]
Lewin, B. et al, Cells, p. 224 (2007). [cited by applicant]
CNLS Mapper Report for [cited by applicant]
Hu, P. et al, “Comparison of Various Nuclear Localization Signal-Fused Cas9 Proteins and Cas9 mRNA for Genome Editing in Zebrafish.” G3, vol. 8, pp. 823-831 (2018). [cited by applicant]
Schultz, J. et al, “Development of a CRISPR/Cas9 system for high efficiency multiplexed gene deletion in Rhodosporidium toruloides.” Biotechnology and Bioengineering, vol. 116, pp. 2103-2109 (2019). [cited by applicant]
Gustafsson, C. et al., “Codon bias and heterologous protein expression.” Trends Biotech., vol. 22(7), pp. 346-353 (2004). [cited by applicant]
Joung, J. et al., “TALENs: a widely applicable technology for targeted genome editing.” Nat. Rev. Mol. Cell Biol., vol. 14, pp. 49-55 (2013). [cited by applicant]
Chang, N. et al, “Genome editing with RNA-guided Cas9 nuclease in Zebrafish embryos.” Call Research, vol. 23, pp. 465-472 (2013). [cited by applicant]
Gratz, S. et al., “Genome engineering of [cited by applicant]
Notice of Opposition filed Oct. 24, 2019 against EP 2825654, and Preliminary Opinion of the Opposition Division. [cited by applicant]
Deltcheva, E. et al., “CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III,” Nature, vol. 471(7340), pp. 602-607 (doi:10.1038/nature09886), plus Supplementary Material (2011). [cited by applicant]
Raymond, C. et al., “High-Efficiency FLP and phiC31 Site-Specific Recombination in Mammalian Cells,” PLoS One, vol. 1 (e162), pp. 1-4 (2007). [cited by applicant]
PHcRed1 Vector Information Sheet, Clontech Laboratories, Inc. (2003). [cited by applicant]
Lyssenko, N. et al., “Cognate putative nuclear localization signal effects strong nuclear localization of a GFP reported and facilitates gene expression studies in Caenhoghabditis elegans,” Biotechniques, vol. 43, pp. 5… [cited by applicant]
PShooter Vector User Guide, Invitrogen (2012). [cited by applicant]
Fischer-Fantuzzi, L. et al., “Cell-Dependent Efficiency of Reiterated Nuclear Signals in a Mutant Simian Virus 40 Oncoprotein Targeted to the Nucleus,” Molecular and Cellular Biology, vol. 8(12), pp. 5495-5503 (1988). [cited by applicant]
Kim, E. et al., “Precision genome engineering with programmable DNA-nicking enzymes,” Genome Res., vol. 22, pp. 1327-1333 (2012). [cited by applicant]
Chen, C. et al., “Transfection and expression of plasmid DNA in plant cells by an arginine-rich intracellular delivery peptide without protoplast preparation,” FEBS Letters, vol. 581, pp. 1891-1897 (2007). [cited by applicant]
Maraia, R. et al., “3′ processing of eukaryotic precursor tRNAs,” Wiley Interdiscip Rev RNA, vol. 2 (3), pp. 362-375 (2010). [cited by applicant]
Gao, Z. et al., “Delineation of the Exact Transcription Termination Signal for Type 3 Polymerase III,” Molecular Therapy—Nucleic Acids, vol. 10, pp. 36-44, plus Supplementary Material (2018). [cited by applicant]
Kalderon, D. et al., “A Short Amino Acid Sequence Able to Specify Nuclear Location,” Cell, vol. 39, pp. 499-509 (1984). [cited by applicant]
Tuschl, T., “Expanding small RNA interference,” Nature Biotechnology, vol. 20, pp. 446-448 (2002). [cited by applicant]
Carroll, D. et al., “Design, construction and in vitro testing of zinc finger nucleases.” Nature Protocols, vol. 1(3), pp. 1329-1341 (2006). [cited by applicant]
Liu, P. et al., “Generation of a Triple-Gene Knockout Mammalian Cell Line Using Engineered Zinc-Finger Nucleases.” Biotechnol Bioeng., vol. 106(1), pp. 97-105 (2010). [cited by applicant]
Lee, H. et al., “Targeted chromosomal deletions in human cells using zinc finger nucleases.” Genome Res., vol. 20, pp. 81-89 (2010). [cited by applicant]
Brunet, E. et al., “Chromosomal translocations induced at specified loci in human stem cells.” PNAS, vol. 106(26), pp. 10620-10625 (2009). [cited by applicant]
Carlson, D. et al., “Targeting DNA With Fingers and TALENs.” Molecular Therapy-Nucleic Acids, vol. 1(e3), pp. 1-4 (2012). [cited by applicant]
Handel, E. et al., “Versatile and Efficient Genome Editing in Human Cells by Combining Zinc-Finger Nucleases With Adeno-Associated Viral Vectors,” Human Gene Ther., vol. 23(2), pp. 321-329 (2012). [cited by applicant]
Li, T. et al., “TAL nucleases (TALNs): hybrid proteins composed of TAL effectors and Fokl DNA-cleavage domain.” Nucleic Adic Res., vol. 39(12), pp. 359-372 (2010). [cited by applicant]
Good et al. “Expression of small, therapeutic RNAs in human cell nuclei” Gene Therapy (1997) 4, pp. 45-54. [cited by applicant]
Al-Attar et al., Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs ): The Hallmark of an Ingenious Antiviral Defense Mechanism in Prokaryotes, Bioi Chern. (20 11) vol. 392, Issue 4, pp. 277-289. [cited by applicant]
Carroll, “A CRISPR Approach to Gene Targeting” 20(9) Molecular Therapy 1658-1660 (Sep. 2012). [cited by applicant]
Gasiunas, G et al Cas9-crRNA Ribonucleoprotein Complex Mediates Specific DNA Cleavage For Adaptive Immunity In Bacteria. PNAS. Sep. 4, 2012. Vol 109, No. 39; pp. E2579-E2586; p. E2583, first column, first paragraph. DOI… [cited by applicant]
Hale et al., Essential Features and Rational Design of CRISPR RNAs That Function With the Cas RAMP Module Complex to Cleave RNAs, Molecular Cell, (20 12) vol. 45, Issue 3, 292-302. [cited by applicant]
Hatoum-Aslan, et al. ‘Mature clustered, regularly interspaced, short palindromic repeats RNA 5,9, 14 (crRNA) length is measured by a ruler mechanism anchored at the precursor processing site.’ Proceedings of the Nationa… [cited by applicant]
Jinek, et al. ‘RNA-programmed genome editing in human cells.’ eLite 2013;2:e00471 . [retrieved 1-3, 6, 7, 10-12 on Mar. 6, .2014). Retrieved from the Internet. <URL: http://elife .elifesciences.org/content/2/e00471 >. e… [cited by applicant]
Jinek, M. et al. “A Programmable Dual-RNA-Guided DNA Endonuclease In Adaptive Bacterial Immunity,” Science. Aug. 17, 2012. vol. 337; pp. 816-821 and Supplementary Materials. [cited by applicant]
Makarova et al., “Evolution and classification of the CRISPR-Cas systems” 9(6) Nature Reviews Microbiology 467-477 (1-23) (Jun. 2011). [cited by applicant]
Rho, Mina et al. ‘Diverse CRISPRs Evolving in Human Microbiomes.’ PLoS Genetics. vol. 8, No. 6. 1-14 pp. 1-12. Jun. 2012. entire document. [cited by applicant]
Sontheimer Erik, Project 7: Establishing RNA-Directed DNA Targeting in Eukaryotic Cells; Project dates: Nov. 16, 2011 to Dec. 31, 2012 (Feb. 4, 2012). [cited by applicant]
Wiedenheft et a!., “RNA-guided genetic silencing systems in bacteria and archaea” 482 Nature 331-338 (Feb. 16, 2012). [cited by applicant]
Gilbert, et al. “CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes”, Cell, Jul. 18, 2013. vol 154 No. 2, pp. 442-451, Elsevier, Inc. [cited by applicant]
International Search Report issued in corresponding PCT/US2013/075326, dated Aug. 22, 2014. [cited by applicant]
International Search Report issued in corresponding PCT/US2013/075317, dated Apr. 15, 2014. [cited by applicant]
U.S. Appl. No. 61/652,086, filed May 25, 2012—Jinek et al. [cited by applicant]
U.S. Appl. No. 61/736,527, filed Dec. 12, 2012—Zhang et al. [cited by applicant]
Office Action issued in U.S. Appl. No. 14/319,530, dated Apr. 1, 2015. [cited by applicant]
U.S. Appl. No. 61/734,256, filed Dec. 6, 2012—Chen, F. et al. [cited by applicant]
Bassett, A.R. and Liu, J.-L., “CRISPR/Cas9 and Genome Editing in Drosophila,” Journal of Genetics and Genomics, 2014, vol. 41, pp. 7-19 (including supplementary materials). [cited by applicant]
Regalado, A., “Who Owns the Biggest Biotech Discovery of the Century?,” MIT Technology 2 Review, Dec. 4, 2014, http://www.technologyreview.com/featuredstory/532796/who-owns-the-biggest-biotech-discovery-of-the-century. [cited by applicant]
Shanks, P., “Crispr Opportunities . . . For What? And For Whom?,” Biopolitical Times, Dec. 4, 2014, http://www.biopoliticaltimes.org/article.php?id=8235. [cited by applicant]
Baker, M., “Gene editing at CRISPR speed,” Nature Biotechnology, 2014, vol. 32(4), pp. 309-312. [cited by applicant]
Qi, L. et al., “RNA Processing Enables Predictable Programming of Gene Expression,” Nature Biotechnology, 2012, vol. 30(1 0), pp. 1002-1007 (including Supplementary Information). [cited by applicant]
Li, T. et al., “Modularly Assembled Designer TAL Effector Nucleases for Targeted Gene Knockout and Gene Replacement in Eukaryotes,” Nucleic Acids Research, 2011, vol. 39(14), pp. 6315-6325. [cited by applicant]
Raymond, C.S. and Soriano, P., “High-Efficiency FLP and PhiC31 Site-Specific Recombination in Mammalian Cells,” PLoS One, 2007, vol. 2(1), p. e162. [cited by applicant]
Mali, P. et al., “Cas9 as a Versatile Tool for Engineering Biology,” Nature Methods, 2013, vol. 10 (1 0), pp. 957-963. [cited by applicant]
Office Action issued in U.S. Appl. No. 14/319,380 dated Jan. 28, 2015. [cited by applicant]
Letter of Payam Moradian dated Apr. 6, 2015. [cited by applicant]
Caroll, Dana, “Zinc-finger Nucleases as Gene Therapy Agents”, Gene Ther., 2008, vol. 15, No. 22, pp. 1463-1468. [cited by applicant]
Miller, Jeffrey C. et al., “A Tale nuclease architecture for efficient genome editing”, Nature Biotechnology, 2011, vol. 29, No. 2, pp. 143-148. [cited by applicant]
Porteus, Matthew H. et al., “Chimeric Nucleases Stimulate Gene Targeting in Human Cells”, Science, 2003, vol. 300, p. 763. [cited by applicant]
Lee, Ciaran M., et al., “Correction of the DF508 Mutation in the Cystic Fibrosis Transmembrance Conductance Regulator Gene by Zinc-Finger Nuclease Homology-Directed Repair”, BioResearch Open Access?Jun. 2012, vol. 1, pp… [cited by applicant]
Gaj, Thomas et al., “Targeted gene knockout by direct delivery of zinc-finger nuclease proteins”, Nature Methods, Aug. 2012, vol. 9, pp. 805-809. [cited by applicant]
Sylwia Bobis-Wozowicz, Anna Osiak et al., “Targeted genome editing in pluripotent stem cells using zinc-finger nucleases”, Methods, 2011, vol. 53, pp. 339-346. [cited by applicant]
Mali, Prashant et al., “RNA-Guided Human Genome Engineering via Cas9”, Science, Feb. 15, 2013, vol. 339, pp. 823-826. [cited by applicant]
Interview_Presentation_Dec. 2017. [cited by applicant]
Le Rhun, Anais et al., “Small RNAs in streptococci,” RNA Biology, Apr. 2012, vol. 9, pp. 414-426. [cited by applicant]
Cong, Le et al., Multiplex Genome Engineering Using CRISPR/Cas Systems, Science vol. 339, Issue 6121, pp. 819-823, Feb. 15, 2013. [cited by applicant]
Transmittal of third party observations & third party observations issued for European Patent Application No. 13863815.0 on Feb. 21, 2019. [cited by applicant]
Observations under Art. 115 EPC issued for EP 13863815.0, issued Feb. 21, 2019. [cited by applicant]
Transmittal of third party observations and third party observations issued for European Patent Application No. 13863815.0 on Feb. 26, 2019. [cited by applicant]
Formal observations under Art. 115 EPC for European Patent Application No. 13863815.0 issued Feb. 26, 2019. [cited by applicant]
Transmittal of third party observations issued for European Patent Application No. 13863815.0 on Sep. 4, 2018. [cited by applicant]
Formal observations under Art. 115 EPC for European Patent Application No. 13863815.0 issued Sep. 4, 2018. [cited by applicant]
Office Action issued for Japanese Application No. 2018-230081 on Oct. 29, 2019. [cited by applicant]
Rebar, E.J. et al. “Induction of angiogenesis in a mouse model using engineered transcription factors.” Nature Medicine. 8: 1427-1432 (2002). [cited by applicant]
Perez-Pinera, P. “Advances in Targeted Genome Editing.” Current Opinion in Chemical Biology, 16 (3-4), 268-277 (2012). [cited by applicant]
Hwang, W. et al. “Efficient genome editing in zebrafish using a CRISPR-Cas system.” Nature Biotechnology 31, 227-229 (2013), and Supplementary Materials. [cited by applicant]
Campeau, E. et al. “A versatile viral system for expression and depletion of proteins in mammalian cells.” PLoS One 4, e6529 (2009). [cited by applicant]
Radulovich, N. et al. “Modified gateway system for double shRNA expression and Cre/lox based gene expression.” BMC Biotech. 11, 1-9 (2011). [cited by applicant]
Hsu Patrick D. et al., “DNA targeting specificity of RNA-guided Cas9 nucleases”, National Biotechnology, vol. 31, No. 9, Sep. 2013. [cited by applicant]
Smith et al. “Robust, Persistent Transgene Expression in Human Embryonic Stem Cells Is Achieved with AAVS1-Targeted Integration” Stem Cells; 26; pp. 496-504; 2008. [cited by applicant]
U.S. Appl. No. 61/748,427, filed Jan. 2, 2013—Zhang et al. [cited by applicant]
U.S. Appl. No. 61/779,169, filed Mar. 13, 2013—Mali et al. [cited by applicant]
U.S. Appl. No. 61/734,256, filed Dec. 6, 2012—Chen et al. [cited by applicant]
Zhou et al., “Large chromosomal deletions and heritable small genetic changes induced by CRISPR/Cas9 in rice” Nucleic Acids Research; vol. 42; No. 17; Published online Sep. 8, 2014; pp. 10903-10914. [cited by applicant]
Lander et al., “Initial sequencing and analysis of the human genome,” Nature, vol. 409, Feb. 15, 2001, pp. 860-921. [cited by applicant]
McShan et al., “Complete genome sequence of an M1 strain of [cited by applicant]
Hatfull et al., “Bacteriophage Genomics,” Curr Opin Microbiol., vol. 11, No. 5, Oct. 11, 2008, pp. 1-10. [cited by applicant]
O'Neill et al., “Nucleosome Arrays Inhibit Both Initiation and Elongation of Transcripts by Bacteriophage T7 RNA Polymerase,” J. Mol. Biol., vol. 223, 1992, pp. 67-78. [cited by applicant]
Jenuwein et al., “The immunoglobulin u enhancer core establishes local factor access in nuclear chromatin independent of transcriptional stimulation,” Genes & Development, vol. 7, No. 10, 1993, pp. 2016-2032. [cited by applicant]
Close et al., “Expression of Non-Native Genes in a Surrogate Host Organism,” Genetic Engineering—Basics, New Applications and Responsibilities, Jan. 18, 2012, 33 pages. [cited by applicant]
U.S. Appl. No. 61/717,324, filed Oct. 23, 2012—Kim et al. [cited by applicant]
McCall et al., “Probes for chromatin accessibility in the [cited by applicant]
Karpala et al., “Immune responses to dsRNA: Implications for gene silencing technologies,” Immunology and Cell Biology, vol. 83, 2005, pp. 211-216. [cited by applicant]
Elbashir et al., “Immune responses to dsRNA: Implications for gene silencing technologies,” Nature, vol. 411, May 24, 2001, pp. 494-498. [cited by applicant]
Wostenberg et al., “The Role of Human Dicer-dsRBD in Processing Small Regulatory RNAs,” PLOS One, vol. 7, No. 12, Dec. 2012, pp. 1-12. [cited by applicant]
Starega-Roslan et al., “The role of the precursor structure in the biogenesis of microRNA,” Cellular and Molecular Life Sciences, vol. 68, 2001, pp. 2859-2871. [cited by applicant]
Yang et al., “Functional parameters of Dicer-independent microRNA biogenesis,” RNA, vol. 18, No. 5, 2012, pp. 945-957. [cited by applicant]
Romani, “Cellular Magnesium Homeostasis,” Arch Biochem Biophys., vol. 512, Aug. 1, 2011, pp. 1-47. [cited by applicant]
Henrich et al., “Effects of anoxia, aglycemia, and acidosis on cytosolic Mg2+, ATP, and pH in rat sensory neurons,” Am J Physiol Cell Physiol., vol. 294, 2007, pp. C280-C294. [cited by applicant]
Rabuka et al., Catalyst Magazine, College of Chemistry, UC Berkeley, vol. 9, No. 1, 2014, 32 pages. [cited by applicant]
Sanders “Cheap and easy technique to snip DNA could revolutionize gene therapy” Berkeley News; Jan. 7, 2013; https://news.berkeley.edu/2013/01/07/cheap-and-easy-technique-to-snip-dna-could-revolutionize-gene-therapy/. [cited by applicant]
Goldberg, “Protein degradation and protection against misfolded or damaged proteins” Nature; Dec. 18, 2003; vol. 426; pp. 895-899. [cited by applicant]
Koseki et al., “Factors Governing the Activity In Vivo of Ribozymes Transcribed by RNA Polymerase III,” J. Virol., vol. 73, No. 3, 1999, pp. 1868-1877. [cited by applicant]
Loonstra et al., “Growth inhibition and DNA damage induced by Cre recombinase in mammalian cells” PNAS, Jul. 31, 2001; vol. 98; No. 16; pp. 9209-9214. [cited by applicant]
Declaration of Dr. Kühn. [cited by applicant]
Declaration of Dr. Seeger. [cited by applicant]
Declaration of Dr. C. Martin Lawrence. [cited by applicant]
Declaration of Dr. Hannon. [cited by applicant]
Dec. 16, 2013—(PCT) Figures as originally filed—Appl. No. PCT/US2013/075317. [cited by applicant]
Dec. 16, 2013—(PCT) Application body as filed—Appl. No. PCT/US2013/075317. [cited by applicant]
Wikipedia contributors, “Transcription activator-like effector nuclease,” Wikipedia, The Free Encyclopedia, <https://en.wikipedia.org/wiki/Transcription_activator-like_effector> (accessed Feb. 27, 2025). [cited by applicant]
Cornell University, “CRISPR-Cas3 innovation holds promise for disease cures, advancing science,” ScienceDaily, www.sciencedaily.com/releases/2019/04/190411172519.htm Apr. 11, 2019, two pages. [cited by applicant]
United States Patent Trial and Appeal Board, [cited by applicant]