IP Library › Granted Patent US 12,662,669
Granted Patent B2
US 12,662,669 · App. 18/362,190 · Granted Jun 23, 2026

RAAV-based compositions and methods for treating amyotrophic lateral sclerosis

Inventors: Christian Mueller (Worcester, MA); Robert H. Brown, Jr. (Worcester, MA)
Assignee: University of Massachusetts
C12N15/113C12N15/111C12N15/1137C12N15/86C12Y115/01001C12N2310/14C12N2310/141C12N2320/32C12N2330/51C12N2750/14143
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 12,662,669
App. No.
18/362,190
Filed
Jul 31, 2023
Granted
Jun 23, 2026
Kind
B2
Art Unit
1636
USPC
424/93.2
Abstract

The invention relates to inhibitory nucleic acids and rAAV-based compositions, methods and kits useful for treating Amyotrophic Lateral Sclerosis.

Claims (23)

1 . A method of treating a subject having or suspected of having ALS, the method comprising:

administering to the subject an effective amount of a recombinant adeno-associated virus (rAAV) harboring a nucleic acid that is engineered to express, in a cell of the subject, a miRNA that targets RNA encoded by a SOD1 gene,

wherein the miRNA comprises 21 continuous nucleotides encoded by a sequence set forth in SEQ ID NO: 17: CTGCATGGATTCCATGTTCAT (SOD-miR-127),

wherein the rAAV comprises an AAV.Rh10 capsid protein.

2 . The method of claim 1 , wherein the rAAV targets CNS tissue.

3 . The method of claim 1 , wherein the rAAV is administered intrathecally, intracerebrally, intraventricularly or intravenously.

4 . The method of claim 1 , wherein the microRNA further comprises flanking regions of miR-155.

5 . The method of claim 1 , wherein the nucleic acid further comprises AAV2 inverted terminal repeats (ITRs).

6 . The method of claim 1 , wherein the nucleic acid further comprises a promoter operably linked with a region(s) encoding the miRNA.

7 . The method of claim 6 , wherein the promoter is a tissue-specific promoter.

8 . The method of claim 7 , wherein the promoter is a polymerase II promoter or a polymerase III promoter.

9 . A recombinant nucleic acid comprising a sequence set forth in 21 consecutive nucleotides of SEQ ID NO: 17, flanking regions of miR-155, and further comprising an inverted terminal repeat (ITR) of AAV2.

10 . The recombinant nucleic acid of claim 9 , further comprising a promoter operably linked with a region(s) encoding the miRNA.

11 . The recombinant nucleic acid of claim 10 , wherein the promoter is a tissue-specific promoter.

12 . The recombinant nucleic acid of claim 11 , wherein the promoter is a polymerase II promoter.

13 . The recombinant nucleic acid of claim 11 , wherein the promoter is a polymerase III promoter.

14 . A composition comprising the recombinant nucleic acid of claim 9 .

15 . A recombinant Adeno-Associated Virus (AAV) comprising a recombinant nucleic acid encoding a miRNA comprising 21 consecutive nucleotides encoded by a sequence as set forth in SEQ ID NO: 17, flanking regions of miR-155, and further comprising a capsid protein of AAV.Rh10.

16 . The recombinant AAV of claim 15 , wherein the recombinant nucleic acid comprises an inverted terminal repeat (ITR) of AAV2.

17 . The recombinant AAV (rAAV) of claim 15 , wherein the rAAV is formulated for administration intrathecally, intracerebrally, intraventricularly or intravenously.

18 . A composition comprising the recombinant AAV of claim 15 .

19 . The composition of claim 18 , further comprising a pharmaceutically acceptable carrier.

20 . A kit comprising a container comprising the composition of claim 18 .

Assignments (1)
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Aug 29, 2023
From: MUELLER, CHRISTIAN; BROWN, ROBERT H., JR.
To: UNIVERSITY OF MASSACHUSETTS
Reel/Frame 064732/0644 →
Continuity (5)
Division 17174452 · Feb 12, 2021
Continuation 16295621 · Mar 7, 2019
Continuation 15126688
Provisional Application 61955189 · Mar 18, 2014
Related Publication 20240076668A1 · Mar 7, 2024
References Cited (400)
US 5478745A · Samulski et al. · 1995 [cited by applicant]
US 5871982A · Wilson et al. · 1999 [cited by applicant]
US 6001650A · Colosi · 1999 [cited by applicant]
US 6156303A · Russell et al. · 2000 [cited by applicant]
US 6177403B1 · Stedman · 2001 [cited by applicant]
US 6251677B1 · Wilson et al. · 2001 [cited by applicant]
US 6485966B2 · Gao et al. · 2002 [cited by applicant]
US 6544786B1 · Xiao et al. · 2003 [cited by applicant]
US 6953690B1 · Gao et al. · 2005 [cited by applicant]
US 7022519B2 · Gao et al. · 2006 [cited by applicant]
US 7132530B2 · Bennett et al. · 2006 [cited by applicant]
US 7198951B2 · Gao et al. · 2007 [cited by applicant]
US 7235393B2 · Gao et al. · 2007 [cited by applicant]
US 7387896B2 · Turner et al. · 2008 [cited by applicant]
US 7427396B2 · Arbetman et al. · 2008 [cited by applicant]
US 7456015B2 · Bohn et al. · 2008 [cited by applicant]
US 7498316B2 · Xu et al. · 2009 [cited by applicant]
US 7622455B2 · Bennett et al. · 2009 [cited by applicant]
US 7678895B2 · Bennett et al. · 2010 [cited by applicant]
US 7691995B2 · Zamore et al. · 2010 [cited by applicant]
US 7750144B2 · Zamore et al. · 2010 [cited by applicant]
US 7772203B2 · Zamore et al. · 2010 [cited by applicant]
US 7892793B2 · Xu · 2011 [cited by applicant]
US 7902163B2 · Bennett et al. · 2011 [cited by applicant]
US 7906111B2 · Wilson et al. · 2011 [cited by applicant]
US 8008271B2 · Xu et al. · 2011 [cited by applicant]
US 8202846B2 · Hannon et al. · 2012 [cited by applicant]
US 8222221B2 · Corey et al. · 2012 [cited by applicant]
US 8309533B2 · Xu · 2012 [cited by applicant]
US 8524446B2 · Gao et al. · 2013 [cited by applicant]
US 8729036B2 · Zamore et al. · 2014 [cited by applicant]
US 8734809B2 · Gao et al. · 2014 [cited by applicant]
US 8993529B2 · Bennett et al. · 2015 [cited by applicant]
US 9102949B2 · Gao et al. · 2015 [cited by applicant]
US 9121018B2 · Zamore et al. · 2015 [cited by applicant]
US 9193753B2 · Tuschl et al. · 2015 [cited by applicant]
US 9217155B2 · Gao et al. · 2015 [cited by applicant]
US 9226976B2 · Flotte et al. · 2016 [cited by applicant]
US 9249424B2 · Wolf et al. · 2016 [cited by applicant]
US 9272053B2 · Gao et al. · 2016 [cited by applicant]
US 9284357B2 · Gao et al. · 2016 [cited by applicant]
US 9546369B2 · Gao et al. · 2017 [cited by applicant]
US 9596835B2 · Gao et al. · 2017 [cited by applicant]
US 9611472B2 · Zamore et al. · 2017 [cited by applicant]
US 9701984B2 · Gao et al. · 2017 [cited by applicant]
US 9725719B2 · Kaspar · 2017 [cited by examiner]
US 9850487B2 · Zamore et al. · 2017 [cited by applicant]
US 9879253B2 · Zamore et al. · 2018 [cited by applicant]
US 9885057B2 · Flotte et al. · 2018 [cited by applicant]
US 10072251B2 · Gao et al. · 2018 [cited by applicant]
US 10077452B2 · Flotte et al. · 2018 [cited by applicant]
US 10166297B2 · Gao et al. · 2019 [cited by applicant]
US 10280418B2 · Mueller et al. · 2019 [cited by applicant]
US 10300146B2 · Gao et al. · 2019 [cited by applicant]
US 10370432B2 · Esteves et al. · 2019 [cited by applicant]
US 10597656B2 · Flotte et al. · 2020 [cited by applicant]
US 10711274B2 · Mueller et al. · 2020 [cited by applicant]
US 10781453B2 · Heslin et al. · 2020 [cited by applicant]
US 10793861B2 · Kaspar et al. · 2020 [cited by applicant]
US 10954518B2 · Mueller et al. · 2021 [cited by applicant]
US 11739330B2 · Mueller et al. · 2023 [cited by applicant]
US 11760999B2 · Mueller et al. · 2023 [cited by applicant]
US 11859179B2 · Mueller et al. · 2024 [cited by applicant]
US 12312587B2 · Mueller et al. · 2025 [cited by applicant]
US 12529051B2 · Mueller et al. · 2026 [cited by applicant]
US 20010016355A1 · Samulski et al. · 2001 [cited by applicant]
US 20020164783A1 · Feldhaus · 2002 [cited by applicant]
US 20020192823A1 · Bartlett · 2002 [cited by applicant]
US 20030103939A1 · Engelhardt et al. · 2003 [cited by applicant]
US 20030110526A1 · Brown et al. · 2003 [cited by applicant]
US 20030138772A1 · Gao et al. · 2003 [cited by applicant]
US 20040101514A1 · Liu et al. · 2004 [cited by applicant]
US 20040219528A1 · Morris et al. · 2004 [cited by applicant]
US 20050014262A1 · Gao et al. · 2005 [cited by applicant]
US 20050019915A1 · Bennett et al. · 2005 [cited by applicant]
US 20050032219A1 · Aubourg et al. · 2005 [cited by applicant]
US 20050037988A1 · Zamore et al. · 2005 [cited by applicant]
US 20050137153A1 · McSwiggen et al. · 2005 [cited by applicant]
US 20050197313A1 · Roelvink et al. · 2005 [cited by applicant]
US 20050255086A1 · Davidson et al. · 2005 [cited by applicant]
US 20050255089A1 · Chiorini et al. · 2005 [cited by applicant]
US 20050255487A1 · Khvorova et al. · 2005 [cited by applicant]
US 20050261218A1 · Esau et al. · 2005 [cited by applicant]
US 20050287122A1 · Bartlett et al. · 2005 [cited by applicant]
US 20050288243A1 · Xu et al. · 2005 [cited by applicant]
US 20060063174A1 · Turner et al. · 2006 [cited by applicant]
US 20060093589A1 · Warrington et al. · 2006 [cited by applicant]
US 20060153826A1 · Arnould et al. · 2006 [cited by applicant]
US 20060189564A1 · Burright et al. · 2006 [cited by applicant]
US 20060228800A1 · Lin et al. · 2006 [cited by applicant]
US 20060229268A1 · Benjamin et al. · 2006 [cited by applicant]
US 20060292117A1 · Loiler et al. · 2006 [cited by applicant]
US 20070036760A1 · Wilson et al. · 2007 [cited by applicant]
US 20070243526A1 · Kay et al. · 2007 [cited by applicant]
US 20070253936A1 · Kay et al. · 2007 [cited by applicant]
US 20070292410A1 · Cashman et al. · 2007 [cited by applicant]
US 20080200420A1 · Zamore et al. · 2008 [cited by applicant]
US 20090042828A1 · Xu et al. · 2009 [cited by applicant]
US 20090111766A1 · Atkinson et al. · 2009 [cited by applicant]
US 20090149409A1 · Bohn et al. · 2009 [cited by applicant]
US 20090197338A1 · Vandenberghe et al. · 2009 [cited by applicant]
US 20090215879A1 · DiPrimio et al. · 2009 [cited by applicant]
US 20090239240A1 · Chu · 2009 [cited by applicant]
US 20100186103A1 · Gao et al. · 2010 [cited by applicant]
US 20100323001A1 · Pachuk · 2010 [cited by applicant]
US 20110039914A1 · Pavco et al. · 2011 [cited by applicant]
US 20110171262A1 · Bakker et al. · 2011 [cited by applicant]
US 20110172293A1 · Fish et al. · 2011 [cited by applicant]
US 20110212520A1 · Davidson et al. · 2011 [cited by applicant]
US 20110258716A1 · Baltimore et al. · 2011 [cited by applicant]
US 20120077870A1 · Blanks et al. · 2012 [cited by applicant]
US 20120137379A1 · Gao et al. · 2012 [cited by applicant]
US 20120270930A1 · Van Der Maarel et al. · 2012 [cited by applicant]
US 20120309050A1 · Kumon et al. · 2012 [cited by applicant]
US 20130030042A1 · Couto · 2013 [cited by applicant]
US 20130101558A1 · Gao et al. · 2013 [cited by applicant]
US 20130109742A1 · Hewitt et al. · 2013 [cited by applicant]
US 20130142861A1 · Tsou et al. · 2013 [cited by applicant]
US 20130195801A1 · Gao et al. · 2013 [cited by applicant]
US 20130281516A1 · Gao et al. · 2013 [cited by applicant]
US 20140142161A1 · Flotte et al. · 2014 [cited by applicant]
US 20140142288A1 · Davidson et al. · 2014 [cited by applicant]
US 20140147418A1 · Chiorini et al. · 2014 [cited by applicant]
US 20140179770A1 · Zhang et al. · 2014 [cited by applicant]
US 20140201857A1 · Fahrenkrug et al. · 2014 [cited by applicant]
US 20140296486A1 · Gao et al. · 2014 [cited by applicant]
US 20140335054A1 · Gao et al. · 2014 [cited by applicant]
US 20150065560A1 · Bjorklund et al. · 2015 [cited by applicant]
US 20150252421A1 · Pickering-Brown et al. · 2015 [cited by applicant]
US 20150258180A1 · Mahuran et al. · 2015 [cited by applicant]
US 20150259679A1 · Bennett et al. · 2015 [cited by applicant]
US 20160017005A1 · Asokan et al. · 2016 [cited by applicant]
US 20160024496A1 · Bennett et al. · 2016 [cited by applicant]
US 20160060624A1 · Davidson et al. · 2016 [cited by applicant]
US 20160076054A1 · Auricchio et al. · 2016 [cited by applicant]
US 20160135438A1 · Gao et al. · 2016 [cited by applicant]
US 20160153005A1 · Zhang et al. · 2016 [cited by applicant]
US 20160185832A1 · Drivas et al. · 2016 [cited by applicant]
US 20160186211A1 · Flotte et al. · 2016 [cited by applicant]
US 20160194374A1 · Wijnholds et al. · 2016 [cited by applicant]
US 20160208257A1 · Gao et al. · 2016 [cited by applicant]
US 20160230172A1 · Rigo · 2016 [cited by applicant]
US 20160251655A1 · Freier et al. · 2016 [cited by applicant]
US 20160272976A1 · Kaspar · 2016 [cited by applicant]
US 20160326524A1 · Flotte et al. · 2016 [cited by applicant]
US 20170029785A1 · Zhao et al. · 2017 [cited by applicant]
US 20170101645A1 · Brown et al. · 2017 [cited by applicant]
US 20170114340A1 · Mueller et al. · 2017 [cited by applicant]
US 20170145439A1 · Gao et al. · 2017 [cited by applicant]
US 20170152517A1 · Barkats et al. · 2017 [cited by applicant]
US 20170159071A9 · Flotte et al. · 2017 [cited by applicant]
US 20170165377A1 · Gao et al. · 2017 [cited by applicant]
US 20170166927A1 · Gao et al. · 2017 [cited by applicant]
US 20170191039A1 · Gao et al. · 2017 [cited by applicant]
US 20170349911A1 · Gao et al. · 2017 [cited by applicant]
US 20180094267A1 · Heslin et al. · 2018 [cited by applicant]
US 20180140810A1 · Cataltepe et al. · 2018 [cited by applicant]
US 20180214576A1 · Fitzgerald et al. · 2018 [cited by applicant]
US 20180265571A1 · Esteves et al. · 2018 [cited by applicant]
US 20180265863A1 · Esteves et al. · 2018 [cited by applicant]
US 20180265865A2 · Flotte et al. · 2018 [cited by applicant]
US 20180298380A1 · Gao et al. · 2018 [cited by applicant]
US 20180311290A1 · Sena-Esteves et al. · 2018 [cited by applicant]
US 20190211327A1 · Flotte et al. · 2019 [cited by applicant]
US 20190276826A1 · Mueller et al. · 2019 [cited by applicant]
US 20190282709A1 · Gao et al. · 2019 [cited by applicant]
US 20190316126A1 · Mueller et al. · 2019 [cited by applicant]
US 20200032256A1 · Mueller et al. · 2020 [cited by applicant]
US 20200248187A1 · Mueller et al. · 2020 [cited by applicant]
US 20200354716A1 · Mueller et al. · 2020 [cited by applicant]
US 20210246450A1 · Mueller et al. · 2021 [cited by applicant]
US 20230416757A1 · Mueller et al. · 2023 [cited by applicant]
US 20240167025A1 · Mueller et al. · 2024 [cited by applicant]
JP 2011511636A · 2011 [cited by applicant]
JP 2017510298A · 2017 [cited by applicant]
JP 2018538002A · 2018 [cited by applicant]
WO WO2003006477A1 · 2003 [cited by applicant]
WO WO2003042397A2 · 2003 [cited by applicant]
WO WO2005033321A2 · 2005 [cited by applicant]
WO WO2005062937A2 · 2005 [cited by applicant]
WO WO2005116204A1 · 2005 [cited by applicant]
WO WO2006031267A2 · 2006 [cited by applicant]
WO WO2006066066A2 · 2006 [cited by applicant]
WO WO2006119432A2 · 2006 [cited by applicant]
WO WO2007000668A2 · 2007 [cited by applicant]
WO WO2007027775A2 · 2007 [cited by applicant]
WO WO2008091703A2 · 2008 [cited by applicant]
WO WO2008125846A2 · 2008 [cited by applicant]
WO WO2008147839A1 · 2008 [cited by applicant]
WO WO2008150897A2 · 2008 [cited by applicant]
WO WO2009102427A2 · 2009 [cited by applicant]
WO WO2009109665A1 · 2009 [cited by applicant]
WO WO2009146178A1 · 2009 [cited by applicant]
WO WO2010027446A2 · 2010 [cited by applicant]
WO WO2010034314A1 · 2010 [cited by applicant]
WO WO2010071454A1 · 2010 [cited by applicant]
WO WO2010099383A2 · 2010 [cited by applicant]
WO WO2010129021A1 · 2010 [cited by applicant]
WO WO2010138263A2 · 2010 [cited by applicant]
WO WO2011094198A1 · 2011 [cited by applicant]
WO WO2011133890A1 · 2011 [cited by applicant]
WO WO2011135396A1 · 2011 [cited by applicant]
WO WO2013055865A1 · 2013 [cited by applicant]
WO WO2013123503A1 · 2013 [cited by applicant]
WO WO2013170078A1 · 2013 [cited by applicant]
WO WO2013190059A1 · 2013 [cited by applicant]
WO WO2014062691A2 · 2014 [cited by applicant]
WO WO2014114303A1 · 2014 [cited by applicant]
WO WO2014160092A1 · 2014 [cited by applicant]
WO WO2014186746A1 · 2014 [cited by applicant]
WO WO2014197748A2 · 2014 [cited by applicant]
WO WO2015031392A1 · 2015 [cited by applicant]
WO WO2015054676A2 · 2015 [cited by applicant]
WO WO2015057727A1 · 2015 [cited by applicant]
WO WO2015089354A1 · 2015 [cited by applicant]
WO WO2015121501A1 · 2015 [cited by applicant]
WO WO2015143078A1 · 2015 [cited by applicant]
WO WO2015164786A1 · 2015 [cited by applicant]
WO WO2015168666A2 · 2015 [cited by applicant]
WO WO2015195621A1 · 2015 [cited by applicant]
WO WO2016065001A1 · 2016 [cited by applicant]
WO WO2016112132A1 · 2016 [cited by applicant]
WO WO2016167780A1 · 2016 [cited by applicant]
WO WO2016174056A1 · 2016 [cited by applicant]
WO WO2016186772A2 · 2016 [cited by applicant]
WO WO2016187053A1 · 2016 [cited by applicant]
WO WO2016210372A2 · 2016 [cited by applicant]
WO WO2017023724A1 · 2017 [cited by applicant]
WO WO2017109757A1 · 2017 [cited by applicant]
WO WO2018064600A1 · 2018 [cited by applicant]
McMenamin et al. (“Progress and prospects: Immunobiology of gene therapy for neurodegenerative disease: prospects and risks.” Gene Therapy 17.4 (2010): 448-458). [cited by examiner]
Hu, Chuhong, Ronald W. Busuttil, and Gerald S. Lipshutz. “RH10 provides superior transgene expression in mice when compared with natural AAV serotypes for neonatal gene therapy.” The journal of gene medicine 12.9 (2010)… [cited by examiner]
U.S. Appl. No. 16/611,581, filed Nov. 7, 2019, Mueller et al. [cited by applicant]
U.S. Appl. No. 18/505,163, filed Nov. 9, 2023, Mueller et al. [cited by applicant]
U.S. Appl. No. 18/344,926, filed Jun. 30, 2023, Mueller et al. [cited by applicant]
EP 15764861.9, Dec. 15, 2017, Extended European Search Report. [cited by applicant]
EP 20183218.5, Nov. 10, 2020, Partial European Search Report. [cited by applicant]
EP 20183218.5, Mar. 31, 2021, Extended European Search Report. [cited by applicant]
PCT/US2015/021321, Jun. 26, 2015, International Search Report and Written Opinion. [cited by applicant]
PCT/US2015/021321, Sep. 26, 2016, International Preliminary Report on Patentability. [cited by applicant]
U.S. Appl. No. 16/611,581, May 7, 2021, Third Party Submission. [cited by applicant]
EP 18797613.9, Dec. 8, 2020, Extended European Search Report. [cited by applicant]
PCT/US2018/031880, Sep. 14, 2018, Internatioinal Search Report and Written Opinion. [cited by applicant]
PCT/US2018/031880, Nov. 21, 2019, International Preliminary Report on Patentability. [cited by applicant]
EP 18859329.7, May 3, 2021, Extended European Search Report. [cited by applicant]
PCT/US2018/052173, Nov. 30, 2018, International Search Report and Written Opinion. [cited by applicant]
PCT/US2018/052173, Apr. 2, 2020, International Preliminary Report on Patentability. [cited by applicant]
Extended European Search Report for Application No. EP 15764861.9, mailed Dec. 15, 2017. [cited by applicant]
Partial European Search Report for Application No. EP 20183218.5, mailed Nov. 10, 2020. [cited by applicant]
Extended European Search Report for Application No. EP 20183218.5, mailed Mar. 31, 2021. [cited by applicant]
International Search Report and Written Opinion for Application No. PCT/US2015/021321, mailed Jun. 26, 2015. [cited by applicant]
International Preliminary Report on Patentability for Application No. PCT/US2015/021321, mailed Sep. 26, 2016. [cited by applicant]
Extended European Search Report for Application No. EP 18797613.9, mailed Dec. 8, 2020. [cited by applicant]
Third Party Submission under 37 CFR 1.290 for U.S. Appl. No. 16/611,581, filed May 7, 2021. [cited by applicant]
International Search Report and Written Opinion for Application No. PCT/US2018/031880, mailed Sep. 14, 2018. [cited by applicant]
International Preliminary Report on Patentability for Application No. PCT/US2018/031880, mailed Nov. 21, 2019. [cited by applicant]
Extended European Search Report for application No. EP 18859329.7, mailed May 3, 2021. [cited by applicant]
International Search Report and Written Opinion for Application No. PCT/US2018/052173, mailed Nov. 30, 2018. [cited by applicant]
International Preliminary Report on Patentability for Application No. PCT/US2018/052173, mailed Apr. 2, 2020. [cited by applicant]
Aartsma-Rus et al., New insights in gene-derived therapy: the example of Duchenne muscular dystrophy. Ann N Y Acad Sci. Dec. 2010;1214:199-212. doi: 10.1111/j.1749-6632.2010.05836.x. Epub Dec. 1, 2010. [cited by applicant]
Abdallah et al., Gene editing ALS causing (GGGGCC)n repeat expansion in C9orf72 using CRISPER/Cas9 system. Mol Ther. May 2017; 25(5): 299-300. American Society of Gene and Cell Therapy. [cited by applicant]
Adachi et al., Drawing a high-resolution functional map of adeno-associated virus capsid by massively parallel sequencing. Nat Commun 2014;5:3075. doi: 10.1038/ncomms4075. [cited by applicant]
Ahmed et al., A Single Intravenous rAAV Injection as Late as P20 Achieves Efficacious and Sustained CNS Gene Therapy in Canavan Mice. Mol Ther. Jul. 2, 2013. doi: 10.1038/mt.2013.138. [Epub ahead of print]. [cited by applicant]
Akache et al., The 37/67-kilodalton laminin receptor is a receptor for adeno-associated virus serotypes 8, 2, 3, and 9. J Virol. Oct. 2006;80(19):9831-6. [cited by applicant]
Alisky et al., Gene therapy for amyotrophic lateral sclerosis and other motor neuron diseases. Hum Gene Ther. Nov. 20, 2000;11(17):2315-29. [cited by applicant]
Arbuthnot et al., Hepatic delivery of RNA interference activators for therapeutic application. Curr Gene Ther. Apr. 2009;9(2):91-103. [cited by applicant]
Asokan et al., The AAV vector toolkit: poised at the clinical crossroads. Mol Ther. Apr. 2012;20(4):699-708. doi: 10.1038/mt.2011.287. Epub Jan. 24, 2012. [cited by applicant]
Azzouz et al., VEGF delivery with retrogradely transported lentivector prolongs survival in a mouse ALS model. Nature. May 27, 2004;429(6990):413-7. [cited by applicant]
Baek et al., AAV-mediated gene delivery in adult GM1-gangliosidosis mice corrects lysosomal storage in CNS and improves survival. PLoS One. Oct. 18, 2010;5(10):e13468. doi: 10.1371/journal.pone.0013468. [cited by applicant]
Banci et al., SOD1 and amyotrophic lateral sclerosis: mutations and oligomerization. PLoS One. 2008;3(2):e1677. Published Feb. 27, 2008. doi:10.1371/journal.pone.0001677. [cited by applicant]
Berns et al., Biology of adeno-associated virus. Curr Top Microbiol Immunol. 1996;218:1-23. [cited by applicant]
Beutler et al., AAV for pain: steps towards clinical translation. Gene Ther. Apr. 2009; 16(4):461-9. Epub Mar. 5, 2009. [cited by applicant]
Biferi et al., Recombinant AAV9 vectors to silence the mutant SOD1 gene in amyotrophic lateral sclersosis. Human gene therapy. Dec. 2013;24(12):A117. [cited by applicant]
Bish et al., Adeno-associated virus (AAV) serotype 9 provides global cardiac gene transfer superior to AAV1, AAV6, AAV7, and AAV8 in the mouse and rat. Hum Gene Ther. Dec. 2008; 19(12):1359-68. doi: 10.1089/hum.2008.123. [cited by applicant]
Boillée et al., Onset and progression in inherited ALS determined by motor neurons and microglia. Science. Jun. 2, 2006;312(5778):1389-92. [cited by applicant]
Borel et al., Recombinant AAV as a platform for translating the therapeutic potential of RNA interference. Mol Ther. Apr. 2014;22(4):692-701. doi:10.1038/mt.2013.285. Epub Dec. 19, 2013. [cited by applicant]
Bourdenx et al., Systemic gene delivery to the central nervous system using Adeno-associated virus. Front Mol Neurosci. Jun. 2, 2014;7:50. doi: 10.3389/fnmol.2014.00050. eCollection 2014. [cited by applicant]
Brantly et al., Phase I trial of intramuscular injection of a recombinant adeno-associated virus serotype 2 alphal-antitrypsin (AAT) vector in AAT-deficient adults. Hum Gene Ther. Dec. 2006; 17(12):1177-86. [cited by applicant]
Brown et al., A microRNA-regulated lentiviral vector mediates stable correction of hemophilia B mice. Blood. Dec. 15, 2007;110(13):4144-52. Epub Aug. 28, 2007. [cited by applicant]
Brown et al., Endogenous microRNA can be broadly exploited to regulate transgene expression according to tissue, lineage and differentiation state. Nat Biotechnol. Dec. 2007;25(12):1457-67. Epub Nov. 16, 2007. [cited by applicant]
Brown et al., Endogenous microRNA regulation suppresses transgene expression in hematopoietic lineages and enables stable gene transfer. Nat Med. May 2006; 12(5):585-91. Epub Apr. 23, 2006. [cited by applicant]
Buning et al., Receptor targeting of adeno-associated virus vectors. Gene Ther. Jul. 2003;10(14):1142-51. [cited by applicant]
Bussing et al., let-7 microRNAs in development, stem cells and cancer. Trends Mol Med. Sep. 2008;14(9):400-9. doi: 10.1016/j.molmed.2008.07.001. Epub Jul. 31, 2008. [cited by applicant]
Calcedo et al., Worldwide epidemiology of neutralizing antibodies to adeno-associated viruses. J Infect Dis. Feb. 1, 2009;199(3):381-90. [cited by applicant]
Carter et al., Adeno-associated virus gene expression and regulation. CRC Handbook of parvoviruses. 1990:227-54. [cited by applicant]
Carter, in “Handbook of Parvoviruses”, ed., P. Tijsser, CRC Press, pp. 155-168 (1990). [cited by applicant]
Cearley et al., Expanded repertoire of AAV vector serotypes mediate unique patterns of transduction in mouse brain. Mol Ther. Oct. 2008;16(10):1710-8. doi: 10.1038/mt.2008.166. Epub Aug. 19, 2008. [cited by applicant]
Cearley et al., Transduction characteristics of adeno-associated virus vectors expressing cap serotypes 7, 8, 9, and Rh10 in the mouse brain. Mol Ther. Mar. 2006;13(3):528-37. Epub Jan. 18, 2006. [cited by applicant]
Chadderton et al., Improved retinal function in a mouse model of dominant retinitis pigmentosa following AAV-delivered gene therapy. Mol Ther. Apr. 2009;17(4):593-9. Epub Jan. 27, 2009. [cited by applicant]
Chang et al., miR-122, a mammalian liver-specific microRNA, is processed from her mRNA and may downregulate the high affinity cationic amino acid transporter CAT-1. RNA Biol. Jul. 2004;1(2):106-13. Epub Jul. 1, 2004. [cited by applicant]
Chen et al., Comparative study of anti-hepatitis B virus RNA interference by double-stranded adeno-associated virus serotypes 7, 8, and 9. Mol Ther. Feb. 2009;17(2):352-9. Epub Dec. 9, 2008. [cited by applicant]
Chen et al., Efficient transduction of vascular endothelial cells with recombinant adeno- associated virus serotype 1 and 5 vectors. Hum Gene Ther. Feb. 2005;16(2):235-47. [cited by applicant]
Chen et al., Molecular signatures of disease brain endothelia provide new sites for CNS-directed enzyme therapy. Nat Med. Oct. 2009;15(10):1215-8. doi: 10.1038/nm.2025. Epub Sep. 13, 2009. [cited by applicant]
Chen et al., Regulation of immune responses and tolerance: the microRNA perspective. Immunol Rev. May 2013;253(1):112-28. doi:10.1111/imr.12060. [cited by applicant]
Chen et al., Development of hybrid baculovirus vectors for artificial MicroRNA delivery and prolonged gene suppression. Biotechnol Bioeng. Dec. 2011;108(12):2958-67. doi: 10.1002/bit.23250. Epub Jul. 19, 2011. [cited by applicant]
Cheng et al., Development of optimized AAV3 serotype vectors: mechanism of high-efficiency transduction of human liver cancer cells. Gene Ther. Apr. 2012; 19(4):375-84. doi: 10.1038/gt.2011.105. Epub Jul. 21, 2011. [cited by applicant]
Choudhury et al., Identification of Novel vectors capable of CNS transduction in adult mice after single round selection using DNA shuffled AAV capsid library. Mol Ther. May 1, 2013;21(1):S1. [cited by applicant]
Christensen et al., A let-7 microRNA-binding site polymorphism in the KRAS 3′ UTR is associated with reduced survival in oral cancers. Carcinogenesis. Jun. 2009;30(6):1003-7. doi: 10.1093/carcin/bgp099. Epub Apr. 20, 20… [cited by applicant]
Chung et al., Polycistronic RNA polymerase II expression vectors for RNA interference based on BIC/miR-155. Nucleic Acids Res. Apr. 13, 2006;34(7):e53. [cited by applicant]
Ciura et al., Loss of function of C9orf72 causes motor deficits in a zebrafish model of amyotrophic lateral sclerosis. Ann Neurol. Aug. 2013;74(2):180-7. doi: 10.1002/ana.23946. [cited by applicant]
Cleary, Effect of C9orf72 hexanucleotide repeat expansions on human induced pluripotent stem cell derived oligodendrocytes. The University of Edinburgh PhD Dissertation. Jan. 12, 2017. 220 pages. [cited by applicant]
Conlon et al., Ribozyme Approaches towards Down-Regulation of Pi*Z Mutant Human a-1 Anti-Trypsin. Mol. Therapy. 2004;9:S333. Abstract 875. [cited by applicant]
Conrad et al., Safety of single-dose administration of an adeno-associated virus (AAV)-CFTR vector in the primate lung. Gene Ther. Aug. 1996;3(8):658-68. [cited by applicant]
Coulouarn et al., Loss of miR-122 expression in liver cancer correlates with suppression of the hepatic phenotype and gain of metastatic properties. Oncogene. Oct. 8, 2009;28(40):3526-36. doi: 10.1038/onc.2009.211. Epub… [cited by applicant]
Cruz et al., The promise of gene therapy for the treatment of alpha-1 antitrypsin deficiency. Pharmacogenomics. Sep. 2007;8(9):1191-8. [cited by applicant]
Csak et al., microRNA-122 regulates hypoxia-inducible factor-1 and vimentin in hepatocytes and correlates with fibrosis in diet-induced steatohepatitis. Liver Int. Feb. 2015;35(2):532-41. doi: 10.1111/liv.12633. Epub Ju… [cited by applicant]
Czech, MicroRNAs as therapeutic targets. N Engl J Med. Mar. 16, 2006;354(11):1194-5. [cited by applicant]
Davidoff et al., Sex significantly influences transduction of murine liver by recombinant adeno-associated viral vectors through an androgen-dependent pathway. Blood. Jul. 15, 2003;102(2):480-8. Epub Mar. 13, 2003. [cited by applicant]
Davidson et al., Recombinant adeno-associated virus type 2, 4, and 5 vectors: transduction of variant cell types and regions in the mammalian central nervous system. Proc Natl Acad Sci U S A. Mar. 28, 2000;97(7):3428-32. [cited by applicant]
Daya et al., Gene therapy using adeno-associated virus vectors. Clin Microbiol Rev. Oct. 2008;21(4):583-93. doi: 10.1128/CMR.00008-08. [cited by applicant]
Di Giorgio et al., Non-cell autonomous effect of glia on motor neurons in an embryonic stem cell-based ALS model. Nat Neurosci. May 2007;10(5):608-14. Epub Apr. 15, 2007. [cited by applicant]
Dominov et al., A novel dysferlin mutant pseudoexon bypassed with antisense oligonucleotides. Ann Clin Transl Neurol. Sep. 2014; 1(9):703-20. doi: 10.1002/acn3.96. Epub Sep. 27, 2014. [cited by applicant]
Donnelly et al., RNA toxicity from the ALS/FTD C9ORF72 expansion is mitigated by antisense intervention. Neuron. Oct. 16, 2013;80(2):415-28. doi: 10.1016/j.neuron.2013.10.015. Erratum in: Neuron. Nov. 20, 2013;80(4):110… [cited by applicant]
Donnelly et al., RNA toxicity from the ALS/FTD C9ORF72 expansion is mitigated by antisense intervention. Neuron. Oct. 16, 2013;80(Supplemental Information). 33 pages. [cited by applicant]
Duque et al., Intravenous administration of self-complementary AAV9 enables transgene delivery to adult motor neurons. Mol Ther. Jul. 2009; 17(7):1187-96. doi: 10.1038/mt.2009.71. Epub Apr. 14, 2009. [cited by applicant]
Eberling et al., Results from a phase I safety trial of hAADC gene therapy for Parkinson disease. Neurology. May 2, 20080;70(21):1980-3. doi: 10.1212/01.wnl.0000312381.29287.ff. Epub Apr. 9, 2008. [cited by applicant]
Ebert et al., MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells. Nat Methods. Sep. 2007;4(9):721-6. Epub Aug. 12, 2007. [cited by applicant]
Ehlert et al., Cellular toxicity following application of adeno-associated viral vector-mediated RNA interference in the nervous system. BMC Neurosci. Feb. 18, 2010;11:20. [cited by applicant]
Elmén et al., LNA-mediated microRNA silencing in non-human primates. Nature. Apr. 2008;452(17): 896-900. [cited by applicant]
Elmén et al., bAntagonism of microRNA-122 in mice by systemically administered LNA-antimiR leads to up-regulation of a large set of predicted target mRNAs in the liver. Nucleic Acids Res. Mar. 2008;36(4):1153-62. Epub D… [cited by applicant]
Esau et al., miR-122 regulation of lipid metabolism revealed by in vivo antisense targeting. Cell Metab. Feb. 2006;3(2):87-98. [cited by applicant]
Fabani et al., miR-122 targeting with LNA/2′-O-methyl oligonucleotide mixmers, peptide nucleic acids (PNA), and PNA-peptide conjugates. RNA. Feb. 2008; 14(2):336-46. Epub Dec. 11, 2007. [cited by applicant]
Fechner et al., Cardiac-targeted RNA interference mediated by an AAV9 vector improves cardiac function in coxsackievirus B3 cardiomyopathy. J Mol Med (Berl). Sep. 2008;86(9):987-97. doi: 10.1007/s00109-008-0363-x. Epub … [cited by applicant]
Feigin et al., Modulation of metabolic brain networks after subthalamic gene therapy for Parkinson's disease. Proc Natl Acad Sci U S A. Dec. 4, 2007;104(49):19559-64. Epub Nov. 27, 2007. [cited by applicant]
Fernandes et al., Oligonucleotide-Based Therapy for FTD/ALS Caused by the C9orf72 Repeat Expansion: A Perspective. J Nucleic Acids. 2013;2013:208245. doi: 10.1155/2013/208245. Epub Nov. 17, 2013. [cited by applicant]
Fischer et al., Successful transgene expression with serial doses of aerosolized rAAV2 vectors in rhesus macaques. Mol Ther. Dec. 2003;8(6):918-26. [cited by applicant]
Fisher et al., Transduction with recombinant adeno-associated virus for gene therapy is limited by leading-strand synthesis. J Virol. Jan. 1996;70(1):520-32. [cited by applicant]
Flotte et al., Gene therapy for alpha-1 antitrypsin deficiency. Hum Mol Genet. Apr. 15, 2011;20(R1):R87-92. doi: 10.1093/hmg/ddr156. Epub Apr. 16, 2011. [cited by applicant]
Flotte et al., Phase I trial of intramuscular injection of a recombinant adeno-associated virus alpha 1-antitrypsin (rAAV2-CB-hAAT) gene vector to AAT-deficient adults. Hum Gene Ther. Jan. 2004;15(1):93-128. [cited by applicant]
Forman et al., A search for conserved sequences in coding regions reveals that the let-7 microRNA targets Dicer within its coding sequence. Proc Natl Acad Sci U S A. Sep. 30, 2008;105(39):14879-84. doi: 10.1073/pnas.080… [cited by applicant]
Foust et al., Intravascular AAV9 preferentially targets neonatal-neurons and adult-astrocytes. Nature Biotechnology, 27; 59-65 2009. [cited by applicant]
Foust et al., Rescue of the spinal muscular atrophy phenotype in a mouse model by early postnatal delivery of SMN. Nat Biotechnol. Mar. 2010;28(3):271-4. doi: 10.1038/nbt.1610. Epub Feb. 28, 2010. [cited by applicant]
Fraldi et al., Functional correction of CNS lesions in an MPS-IIIA mouse model by intracerebral AAV-mediated delivery of sulfamidase and SUMF1 genes. Hum Mol Genet. Nov. 15, 2007;16(22):2693-702. Epub Aug. 27, 2007. [cited by applicant]
Fu et al., Self-complementary adeno-associated virus serotype 2 vector: global distribution and broad dispersion of AAV-mediated transgene expression in mouse brain. Mol Ther. Dec. 2003;8(6):911-7. [cited by applicant]
Gadalla et al., Improved survival and reduced phenotypic severity following AAV9/MECP2 gene transfer to neonatal and juvenile male Mecp2 knockout mice. Mol Ther. Jan. 2013;21(1):18-30. doi:10.1038/mt.2012.200. Epub Sep.… [cited by applicant]
Gaj et al., Genome Engineering Using Adeno-associated Virus: Basic and Clinical Research Applications. Mol Ther. Mar. 2016;24(3):458-64. doi: 10.1038/mt.2015.151. Epub Sep. 16, 2015. [cited by applicant]
Gao et al., Erythropoietin gene therapy leads to autoimmune anemia in macaques. Blood. May 1, 2004;103(9):3300-2. Epub Dec. 24, 2003. [cited by applicant]
Gao et al., Inadvertent gene transfer of co-packaged rep and cap sequences during the production of AAV vector and its potential impact on vector performance. Molecular Therapy. May 2008; 16(Suppl. 1):S105-S106. Abstrac… [cited by applicant]
Gao et al., Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy. Proc Natl Acad Sci U S A. Sep. 3, 2002;99(18):11854-9. Epub Aug. 21, 2002. [cited by applicant]
Gao et al., RAAV-mediated targeting in adult mice and its potential in generating animal models of tissue-specific somatic transgenics or knock down. Molecular Therapy. May 2008;16(1):S118-S119. Abstract 316. [cited by applicant]
GENBANK Submission; NCBI, Accession No. AAS99264; Gao et al.; Jun. 24, 2004. [cited by applicant]
GENBANK Submission; NCBI, Accession No. AY530579.10; 2004. [cited by applicant]
Gentner et al., Stable knockdown of microRNA in vivo by lentiviral vectors. Nat Methods. Jan. 2009;6(1):63-6. doi: 10.1038/nmeth.1277. Epub Nov. 30, 2008. [cited by applicant]
Georgiadis et al., AAV-mediated knockdown of peripherin-2 in vivo using miRNA-based hairpins. Gene Ther. Apr. 2010;17(4):486-93. doi: 10.1038/gt.2009.162. Epub Dec. 10, 2009. [cited by applicant]
Girard et al., miR-122, a paradigm for the role of microRNAs in the liver. J Hepatol. Apr. 2008;48(4):648-56. doi: 10.1016/j.jhep.2008.01.019. Epub Feb. 12, 2008. [cited by applicant]
Gramantieri et al., Cyclin G1 is a target of miR-122a, a microRNA frequently down-regulated in human hepatocellular carcinoma. Cancer Res. Jul. 1, 2007;67(13):6092-9. [cited by applicant]
Grimm et al., Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Nature. May 25, 2006;441(7092):537-41. [cited by applicant]
Grimm, Small silencing RNAs: state-of-the-art. Adv Drug Deliv Rev. Jul. 25, 2009;61(9):672- 703. doi: 10.1016/j.addr.2009.05.002. Epub May 7, 2009. [cited by applicant]
Haraguchi et al., Vectors expressing efficient RNA decoys achieve the long-term suppression of specific microRNA activity in mammalian cells. Nucleic Acids Res. Apr. 2009;37(6):e43. doi: 10.1093/nar/gkp040. Epub Feb. 17… [cited by applicant]
Haussecker et al., miR-122 continues to blaze the trail for microRNA therapeutics. Mol Ther. Feb. 2010;18(2):240-2. doi: 10.1038/mt.2009.313. [cited by applicant]
Hernandez et al., Latent adeno-associated virus infection elicits humoral but not cell-mediated immune responses in a nonhuman primate model. J Virol. Oct. 1999;73(10):8549-58. [cited by applicant]
Hinderer et al., Widespread gene transfer in the central nervous system of cynomolgus macaques following delivery of AAV9 into the cisterna magna. Mol Ther Methods Clin Dev. Dec. 10, 2014;1:14051. doi: 10.1038/mtm.2014.… [cited by applicant]
Horwich et al., Design and delivery of antisense oligonucleotides to block microRNA function in cultured [cited by applicant]
Hsu et al., Essential metabolic, anti-inflammatory, and anti-tumorigenic functions of miR-122 in liver. J Clin Invest. Aug. 2012;122(8):2871-83. doi: 10.1172/JCI63539. Epub Jul. 23, 2012. [cited by applicant]
Hutvágner et al., Sequence-specific inhibition of small RNA function. PLoS Biol. Apr. 2004;2(4): E98. Epub Feb. 24, 2004. [cited by applicant]
Iida et al., Systemic Delivery of Tyrosine-Mutant AAV Vectors Results in Robust Transduction of Neurons in Adult Mice. BioMed Res Int. 2013;2013. [cited by applicant]
Jakobsson et al., Lentiviral vectors for use in the central nervous system. Mol Ther. Mar. 2006;13(3):484-93. Epub Jan. 3, 2006. [cited by applicant]
Johnson et al., RAS is regulated by the let-7 microRNA family. Cell. Mar. 11, 2005;120(5):635-47. [cited by applicant]
Kaspar et al., Retrograde viral delivery of IGF-1 prolongs survival in a mouse ALS model. Science. Aug. 8, 2003;301(5634):839-42. [cited by applicant]
Koornneef et al., Apolipoprotein B knockdown by AAV-delivered shRNA lowers plasma cholesterol in mice. Mol Ther. Apr. 2011;19(4):731-40. doi:10.1038/mt.2011.6. Epub Feb. 8, 2011. [cited by applicant]
Kota et al., AAV8-Mediated Delivery of miR-26a inhibits cancer cell proliferation and induces tumor-specific apoptosis in a liver cancer model. Mol. Therapy. May 2009. 17(1):S300. Abstract 783. [cited by applicant]
Kota et al., Therapeutic microRNA delivery suppresses tumorigenesis in a murine liver cancer model. Cell. Jun. 12, 2009;137(6):1005-17. doi: 10.1016/j.cell.2009.04.021. [cited by applicant]
Kotin et al., Organization of adeno-associated virus DNA in latently infected Detroit 6 cells. Virology. Jun. 1989;170(2):460-7. [cited by applicant]
Kotin et al., Site-specific integration by adeno-associated virus. Proc Natl Acad Sci U S A. Mar. 1990;87(6):2211-5. [cited by applicant]
Krützfeldt et al., Silencing of microRNAs in vivo with ‘antagomirs’. Nature. Dec. 1, 2005;438(7068):685-9. Epub Oct. 30, 2005. [cited by applicant]
Kubodera et al., In vivo application of an RNAi strategy for the selective suppression of a mutant allele. Hum Gene Ther. Jan. 2011;22(1):27-34. doi: 10.1089/hum.2010.054. PMID: 20649474. [cited by applicant]
Kutay et al., Downregulation of miR-122 in the rodent and human hepatocellular carcinomas. J Cell Biochem. Oct. 15, 2006;99(3):671-8. [cited by applicant]
Lagier-Tourenne et al., Targeted degradation of sense and antisense C9orf72 RNA foci as therapy for ALS and frontotemporal degeneration. Proc Natl Acad Sci U S A. Nov. 19, 2013;110(47):E4530-9. doi: 10.1073/pnas.1318835… [cited by applicant]
Lanford et al., Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection. Science. Jan. 8, 2010;327(5962):198-201. Epub Dec. 3, 2009. [cited by applicant]
Lebedeva et al., Phosphorothioate Oligodeoxynucleotides as Inhibitors of Gene Expression: Antisense and Non-Antisense Effects. In: Rabbani, L.E. (eds) Applications of Antisense Therapies to Restenosis. Perspectives in A… [cited by applicant]
Lewis et al., Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell. Jan. 14, 2005;120(1):15-20. [cited by applicant]
Lewis et al., Prediction of mammalian microRNA targets. Cell. Dec. 26, 2003;115(7):787-98. [cited by applicant]
Li et al., Efficient and Targeted Transduction of Nonhuman Primate Liver With Systemically Delivered Optimized AAV3B Vectors. Mol Ther. Dec. 2015;23(12):1867-76. doi: 10.1038/mt.2015.174. Epub Sep. 25, 2015. [cited by applicant]
Li et al., Intronic microRNA: discovery and biological implications. DNA Cell Biol. Apr. 2007;26(4):195-207. [cited by applicant]
Li et al., Protein trans-splicing as a means for viral vector-mediated in vivo gene therapy. Hum Gene Ther. Sep. 2008;19(9):958-64. doi: 10.1089/hum.2008.009. [cited by applicant]
Liu et al., Altered microRNA expression following traumatic spinal cord injury. Exp Neurol. Oct. 2009;219(2):424-9. doi: 10.1016/j.expneurol.2009.06.015. Epub Jul. 1, 2009. [cited by applicant]
Liu et al., Identification of a novel loss-of-function C9orf72 splice site mutation in a patient with amyotrophic lateral sclerosis. Neurobiol Aging. Nov. 2016;47:219.e1-219.e5. doi: 10.1016/j.neurobiolaging.2016.07.027… [cited by applicant]
Liu et al., miRNA cassettes in viral vectors: problems and solutions. Biochim Biophys Acta. Nov.-Dec. 2011;1809(11-12):732-45. doi: 10.1016/j.bbagrm.2011.05.014. Epub Jun. 7, 2011. [cited by applicant]
Lisowski et al., Adeno-associated virus serotypes for gene therapeutics. Curr Opin Pharmacol. Oct. 2015;24:59-67. doi: 10.1016/j.coph.2015.07.006. Epub Aug. 25, 2015. [cited by applicant]
Lowenstein, Crossing the rubicon. Nat Biotechnol. Jan. 2009;27(1):42-4. [cited by applicant]
Loya et al., Transgenic microRNA inhibition with spatiotemporal specificity in intact organisms. Nat Methods. Dec. 2009;6(12):897-903. doi: 10.1038/nmeth.1402. Epub Nov. 15, 2009. [cited by applicant]
Lux et al., Green fluorescent protein-tagged adeno-associated virus particles allow the study of cytosolic and nuclear trafficking. J Virol. Sep. 2005;79(18):11776-87. [cited by applicant]
Lynn, Meta-regulation: microRNA regulation of glucose and lipid metabolism. Trends Endocrinol Metab. Nov. 2009;20(9):452-9. doi: 10.1016/j.tem.2009.05.007. Epub Sep. 30, 2009. [cited by applicant]
Ma et al., Therapeutic silencing of miR-10b inhibits metastasis in a mouse mammary tumor model. Nat Biotechnol. Apr. 2010;28(4):341-7. doi: 10.1038/nbt.1618. Epub Mar. 28, 2010. [cited by applicant]
Maguire et al., Directed evolution of adeno-associated virus for glioma cell transduction. J Neurooncol. Feb. 2010;96(3):337-47. doi: 10.1007/s11060-009-9972-7. Epub Jul. 19, 2009. [cited by applicant]
Maguire et al., Gene therapy for the nervous system: challenges and new strategies. Neurotherapeutics. Oct. 2014; 11(4):817-39. doi: 10.1007/s13311-014-0299-5. [cited by applicant]
Mandel et al., Recombinant adeno-associated viral vectors as therapeutic agents to treat neurological disorders. Mol Ther. Mar. 2006; 13(3):463-83. Epub Jan. 18, 2006. [cited by applicant]
Manfredsson et al., AAV9: a potential blood-brain barrier buster. Mol Ther. Mar. 2009;17(3):403-5. [cited by applicant]
Matalon et al., Adeno-associated virus-mediated aspartoacylase gene transfer to the brain of knockout mouse for canavan disease. Mol Ther. May 2003;7(5 Pt 1):580-7. [cited by applicant]
Mcbride et al., Artificial miRNAs mitigate shRNA-mediated toxicity in the brain: implications for the therapeutic development of RNAi. Proc Natl Acad Sci U S A. Apr. 15, 2008;105(15):5868-73. Epub Apr. 8, 2008. [cited by applicant]
Mccarty et al., Adeno-associated virus terminal repeat (TR) mutant generates self-complementary vectors to overcome the rate-limiting step to transduction in vivo. Gene Ther. Dec. 2003;10(26):2112-8. [cited by applicant]
Mccarty et al., Integration of adeno-associated virus (AAV) and recombinant AAV vectors. Annu Rev Genet. 2004;38:819-45. [cited by applicant]
Mccarty et al., Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis. Gene Ther. Aug. 2001;8(16):1248-54. [cited by applicant]
Mccarty, Self-complementary AAV vectors; advances and applications. Mol Ther. Oct. 2008;16(10):1648-56. Epub Aug. 5, 2008. [cited by applicant]
Mccurdy et al., Sustained normalization of neurological disease after intracranial gene therapy in a feline model. Sci Transl Med. Apr. 9, 2014;6(231):231ra48. doi: 10.1126/scitranslmed.3007733. [cited by applicant]
Meijer et al., Controlling brain tumor growth by intraventricular administration of an AAV vector encoding IFN-beta. Cancer Gene Ther. Aug. 2009;16(8):664-71. doi: 10.1038/cgt.2009.8. Epub Feb. 6, 2009. [cited by applicant]
Meister et al., Sequence-specific inhibition of microRNA- and siRNA-induced RNA silencing. RNA. Mar. 2004;10(3):544-50. [cited by applicant]
Mietzsch et al., OneBac 2.0: Sf9 Cell Lines for Production of AAV5 Vectors with Enhanced Infectivity and Minimal Encapsidation of Foreign DNA. Hum Gene Ther. Oct. 2015;26(10):688-97. doi:10.1089/hum.2015.050. Epub Aug. … [cited by applicant]
MiRBase accession No. MI0000472. Last accessed on May 18, 2018 at http://www.mirbase.org/cgi-bin/mirna_entry.pl?acc=MI0000472. [cited by applicant]
Moffett et al., N-Acetylaspartate in the CNS: from neurodiagnostics to neurobiology. Prog Neurobiol. Feb. 2007;81(2):89-131. Epub Jan. 5, 2007. [cited by applicant]